Accéder au contenu
Merck
Toutes les photos(1)

Documents

EMU034351

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cd34

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGGTAGCTCTCTGCCTGATGAGTCTGCTGCATCTAAATAACTTGACTTCTGCTACCACGGAGACTTCTACACAAGGAATATCCCCATCAGTTCCTACCAATGAGTCTGTTGAGGAAAATATCACATCTAGCATCCCTGGAAGTACCAGCCACTACTTGATCTATCAGGACAGCAGTAAGACCACACCAGCCATCTCAGAGACTATGGTCAACTTTACAGTTACCTCTGGGATCCCTTCAGGCTCTGGAACTCCACACACTTTTTCACAACCACAGACTTCCCCAACTGGCATACTGCCTACTACTTCAGACAGTATTTCCACTTCAGAGATGACCTGGAAGTCCAGCCTGCCATCTATAAATGTTTCTGATTATTCGCCTAATAATAGCAGCTTTGAGATGACATCACCCACCGAGCCATATGCTTACACATCATCTTCTGCTCCGAGTGCCATTAAGGGAGAAATCAAATGCTCTGGAATCCG

Numéro d'accès Ensembl | souris

ENSMUSG00000016494

Numéro d'accès NCBI

NM_133654

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... CD34(12490) , Cd34(12490)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Tunay Kökten et al.
PloS one, 9(1), e86011-e86011 (2014-01-28)
The sensory innervation of the dental mesenchyme is essential for tooth function and protection. Sensory innervation of the dental pulp is mediated by axons originating from the trigeminal ganglia and is strictly regulated in time. Teeth can develop from cultured
Jun-Feng Liu et al.
Experimental and therapeutic medicine, 8(3), 805-812 (2014-08-15)
The number and function of endothelial progenitor cells (EPCs) may be a predictive factor for the severity and outcome of cardiovascular disease. However, the manipulation of bone marrow mononuclear cell (BMMC) cultures for EPCs is an elaborate and difficult procedure
Luisa Boldrin et al.
PLoS currents, 3, RRN1294-RRN1294 (2012-02-16)
Satellite cells, normally quiescent underneath the myofibre basal lamina, are skeletal muscle stem cells responsible for postnatal muscle growth, repair and regeneration. Since their scarcity and small size have limited study on transverse muscle sections, techniques to isolate individual myofibres
Rifat Jan et al.
Breast cancer research : BCR, 14(6), R146-R146 (2012-11-16)
Despite the benefits of endocrine therapies such as tamoxifen and aromatase inhibitors in treating estrogen receptor (ER) alpha-positive breast cancer, many tumors eventually become resistant. The molecular mechanisms governing resistance remain largely unknown. Pigment epithelium-derived factor (PEDF) is a multifunctional
Princess I Imoukhuede et al.
PloS one, 7(9), e44791-e44791 (2012-09-18)
VEGFR surface localization plays a critical role in converting extracellular VEGF signaling towards angiogenic outcomes, and the quantitative characterization of these parameters is critical for advancing computational models; however the levels of these receptors on blood vessels is currently unknown.
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique