Accéder au contenu
Merck
Toutes les photos(1)

Documents

EMU028351

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Aurka

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGTTGGCAAACGCTCTGTCTTACTGTCATTCAAAGAGAGTGATCCACAGAGACATTAAGCCAGAGAACTTACTGCTTGGCTCAAACGGAGAGTTGAAGATTGCAGACTTCGGGTGGTCGGTGCATGCTCCATCTTCCAGGAGAACCACAATGTGTGGCACCCTGGACTACCTGCCCCCAGAGATGATTGAAGGCCGGATGCATGACGAGAAGGTGGACCTCTGGAGCCTGGGCGTTCTCTGCTATGAGTTCCTAGTGGGGATGCCTCCTTTCGAGGCACATACGTACCAGGAGACTTACAGAAGGATATCTCGGGTTGAATTCACTTTCCCTGACTTTGTGACAGAGGGAGCCAGGGACCTCATTTCAAGACTGTTAAAACACAACGCAAGCCAAAGGCTAACACTAGCGGAAGTCCTTGAGCACCCTTGGATCAAAGCTAATTCTTCCAAACCTCCAACTGG

Numéro d'accès Ensembl | souris

ENSMUSG00000027496

Numéro d'accès NCBI

NM_011497

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... AURKA(20878) , Aurka(20878)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Saishu Yoshida et al.
eLife, 9 (2020-08-08)
Mammalian Hedgehog (Hh) signaling plays key roles in embryogenesis and uniquely requires primary cilia. Functional analyses of several ciliogenesis-related genes led to the discovery of the developmental diseases known as ciliopathies. Hence, identification of mammalian factors that regulate ciliogenesis can
Jingjing Li et al.
Oncotarget, 6(11), 9327-9340 (2015-04-15)
Mitosis is choreographed by a number of protein kinases including polo-like kinases and Aurora kinases. As these kinases are frequently dysregulated in cancers, small-molecule inhibitors have been developed for targeted anticancer therapies. Given that PLK1 and Aurora kinases possess both
Hua Yang et al.
Oncotarget, 5(10), 2947-2961 (2014-06-17)
Aurora A and JAK2 kinases are involved in cell division and tumor cell survival, respectively. Here we demonstrate that ectopic expression of Aurora A and JAK2 together is more effective than each alone at inducing non-transformed cells to grow in
Aarthi Jayanthan et al.
PloS one, 9(7), e102741-e102741 (2014-07-23)
Leukemia is the most common pediatric malignancy, constituting more than 30% of all childhood cancers. Although cure rates have improved greatly, approximately one in five children relapse and poor survival rates post relapse remain a challenge. Given this, more effective

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique