Accéder au contenu
Merck
Toutes les photos(1)

Documents

EMU024081

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Trim28

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGATTCCCAGGATGCTAACCAGTGCTGCACTAGCTGTGAAGATAATGCCCCAGCCACTAGCTATTGTGTGGAGTGCTCTGAACCACTTTGTGAGACCTGTGTGGAGGCTCACCAGCGGGTGAAATACACCAAGGACCACACTGTGCGCTCCACAGGACCTGCTAAGACTCGAGATGGAGAGCGAACAGTCTACTGTAATGTGCACAAGCATGAGCCCCTCGTGCTGTTCTGTGAGAGCTGTGACACACTCACCTGCCGCGACTGCCAGCTCAACGCTCACAAGGACCATCAGTACCAGTTTTTGGAAGATGCAGTGAGGAACCAACGTAAACTCTTGGCTTCACTGGTGAAACGTCTTGGGGACAAACATGCCACACTTCAGAAAAACACCAAGGAGGTTCGAAGCTCGATCCGCCAGGTGTCTGATGTGCAGAAGCGAGTGCAGGTTGAT

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

A Bakr et al.
Nucleic acids research, 43(6), 3154-3166 (2015-03-11)
Ataxia-telangiectasia mutated (ATM) is needed for the initiation of the double-strand break (DSB) repair by homologous recombination (HR). ATM triggers DSB end resection by stimulating the nucleolytic activity of CtIP and MRE11 to generate 3'-ssDNA overhangs, followed by RPA loading
Estela Cruvinel et al.
Human molecular genetics, 23(17), 4674-4685 (2014-04-25)
Prader-Willi syndrome (PWS), a disorder of genomic imprinting, is characterized by neonatal hypotonia, hypogonadism, small hands and feet, hyperphagia and obesity in adulthood. PWS results from the loss of paternal copies of the cluster of SNORD116 C/D box snoRNAs and

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique