Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EMU022801

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ctgf

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCAGGAAGTAAGGGACACGAACTCATTAGACTATAACTTGAACTGAGTTGCATCTCATTTTCTTCTGTAAAAACAATTACAGTAGCACATTAATTTAAATCTGTGTTTTTAACTACCGTGGGAGGAACTATCCCACCAAAGTGAGAACGTTATGTCATGGCCATACAAGTAGTCTGTCAACCTCAGACACTGGTTTCGAGACAGTTTACACTTGACAGTTGTTCATTAGCGCACAGTGCCAGAACGCACACTGAGGTGAGTCTCCTGGAACAGTGGAGATGCCAGGAGAAAGAAAGACAGGTACTAGCTGAGGTTATTTTAAAAGCAGCAGTGTGCCTACTTTTTGGAGTGTAACCGGGGAGGGAAATTATAGCATGCTTGCAGACAGACCTGCTCTAGCGAGAGCTGAGCATGTGTCCTCCACTAGATGAGGCTGAGTCCAGCTGT

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

James Hutchenreuther et al.
The Journal of investigative dermatology, 135(11), 2805-2813 (2015-07-15)
Metastatic melanoma has an extremely poor prognosis with few durable remissions. The secreted matricellular protein connective tissue growth factor (CCN2) is overexpressed in cancers including melanoma and may represent a viable therapeutic target. However, the mechanism underlying the contribution of
Tian Tian et al.
American journal of cancer research, 5(5), 1823-1830 (2015-07-16)
Glioblastoma multiforme (GBM) is the deadliest and most common form of malignant primary brain tumor in humans. However, until now, little is known about the glioma genesis and progression at the molecular level. Here we report that overexpression of sine
Yunzhuo Ren et al.
Drug design, development and therapy, 9, 4155-4171 (2015-08-11)
Transforming growth factor-β1 (TGF-β1) plays an important role in the pathogenesis and progression of chronic kidney disease. Connective tissue growth factor (CTGF) is a critical fibrogenic mediator of TGF-β1. Mammalian sirtuin 1 (Sirt1) is reported to attenuate renal fibrosis by
Chien-Huang Lin et al.
PloS one, 9(8), e104746-e104746 (2014-08-15)
CXCL12 (stromal cell-derived factor-1, SDF-1) is a potent chemokine for homing of CXCR4+ fibrocytes to injury sites of lung tissue, which contributes to pulmonary fibrosis. Overexpression of connective tissue growth factor (CTGF) plays a critical role in pulmonary fibrosis. In

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique