Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EMU021131

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Notch4

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AAGGAAGGAAGCGACACGTACGAGTCTGGAAGACTCCGGACTTTTAAGGCCAAAATAACCGTTAAGCTCACTTGTCTCCCCCATAGAGTATGCACAGCAATGGGAAGAGGGTTTAGGATGTCCGGTTGAGATAGACCGTGATTTTCCTGGAAAATAGGGCAGCTTCAAGAGGACAAAGTTGATTTCGAGAATCCCTAAACTCTGGAACCAAGAACTGTGGGCGAATTGGGTGTAAAATGTTTCTTGAGTATGGTTTCCCAAAAGGAGCCTCTGCTATCTACTGCCCACAAGTAGCTGGCAACTATTTATTAAGCACCTACGATGTGCCGGGTGTTGTGTAGATGATGAACAGTAACCAGTGGCCCATCCAGCTGATGACTCCTTGCCCTCTCTCTGCCTCCCCACAAGGACACTGGTGCAGGGATGAGGCCATGTTCTCCAGT

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Cui-Juan Qian et al.
Oncology letters, 12(5), 3499-3505 (2016-12-03)
Overexpression of Notch4 is associated with a variety of tumor types. Only sparse information exists on Notch4 expression in pancreatic cancer (PC). The present study demonstrated that Notch4 expression was significantly upregulated in PC cell lines compared with a non-transformed
Quyen Thu Bui et al.
Cancer letters, 390, 115-125 (2017-01-22)
We previously demonstrated that tamoxifen (TAM)-resistant human breast cancer (TAMR-MCF-7) cells showed increased expression of mesenchymal marker proteins compared to the parent MCF-7 cells. Notch is functionally important in the promotion of epithelial-mesenchymal transition (EMT) during both development and tumor
Hebah A Sindi et al.
Nature communications, 11(1), 1185-1185 (2020-03-07)
Pulmonary arterial hypertension (PAH) is a severe disorder of lung vasculature that causes right heart failure. Homoeostatic effects of flow-activated transcription factor Krüppel-like factor 2 (KLF2) are compromised in PAH. Here, we show that KLF2-induced exosomal microRNAs, miR-181a-5p and miR-324-5p

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique