Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EMU015631

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Lamp1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ACATCAGCCCAAATGACACATCTAGTGGGAGTTGCGGTATCAACTTGGTGACCCTGAAAGTGGAGAACAAGAACAGAGCCCTGGAATTGCAGTTTGGGATGAATGCCAGCTCTAGCCTGTTTTTCTTGCAAGGAGTGCGCTTGAATATGACTCTTCCTGATGCCCTAGTGCCCACATTCAGCATCTCCAACCATTCACTGAAAGCTCTTCAGGCCACTGTGGGAAACTCATACAAGTGCAACACTGAGGAACACATCTTTGTCAGCAAGATGCTCTCCCTCAATGTCTTCAGTGTGCAGGTCCAGGCTTTCAAGGTGGACAGTGACAGGTTTGGGTCTGTGGAAGAGTGTGTTCAGGATGGTAACAACATGTTGATCCCCATTGCTGTGGGCGGTGCCCTGGCAGGGCTGATCCTCATCGTCCTCATTGC

Numéro d'accès Ensembl | souris

ENSMUSG00000031447

Numéro d'accès NCBI

NM_010684

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... LAMP1(16783) , Lamp1(16783)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Akhil Kumar Agarwal et al.
Biochemical and biophysical research communications, 449(3), 332-337 (2014-05-23)
Lysosome Associated Membrane Protein-1 (LAMP1), which lines the lysosomes, is often found to be expressed on surface of metastatic cells. We previously demonstrated that its surface expression on B16 melanoma variants correlates with metastatic potential. To establish the role of
Xiang Y Kong et al.
Disease models & mechanisms, 7(3), 351-362 (2014-02-04)
Human kidney predominant protein, NCU-G1, is a highly conserved protein with an unknown biological function. Initially described as a nuclear protein, it was later shown to be a bona fide lysosomal integral membrane protein. To gain insight into the physiological
Takahito Miyake et al.
Glia, 63(10), 1870-1882 (2015-05-27)
Microglia, the resident immune cells in the brain, survey the environment of the healthy brain. Microglial migration is essential for many physiological and pathophysiological processes. Although microglia express some members of the transient receptor potential (TRP) channel family, there is

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique