Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EMU005531

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Tlr3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme

Sélectionner une taille de conditionnement

20 μG
192,00 €
50 μG
341,00 €

192,00 €


Veuillez contacter notre Service Clients pour connaître la disponibilité de ce produit.


Sélectionner une taille de conditionnement

Changer de vue
20 μG
192,00 €
50 μG
341,00 €

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

192,00 €


Veuillez contacter notre Service Clients pour connaître la disponibilité de ce produit.

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CAGGGATTGCACCCATAATCTGGGCTGAATCATGAAAGGGTGTTCCTCTTATCTAATGTACTCCTTTGGGGGACTTTTGTCCCTATGGATTCTTCTGGTGTCTTCCACAAACCAATGCACTGTGAGATACAACGTAGCTGACTGCAGCCATTTGAAGCTAACACACATACCTGATGATCTTCCCTCTAACATAACAGTGTTGAATCTTACTCACAACCAACTCAGAAGATTACCACCTACCAACTTTACAAGATACAGCCAACTTGCTATCTTGGATGCAGGATTTAACTCCATTTCAAAACTGGAGCCAGAACTGTGCCAAATACTCCCTTTGTTGAAAGTATTGAACCTGCAACATAATGAGCTCTCTCAGATTTCTGATCAAACCTTTGTCTTCTGCACGAACCTG

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Jian Ma et al.
Veterinary research, 45, 82-82 (2014-08-12)
The Chinese attenuated equine infectious anemia virus (EIAV) vaccine has successfully protected millions of equine animals from EIA disease in China. Given that the induction of immune protection results from the interactions between viruses and hosts, a better understanding of
K Mori et al.
Journal of dental research, 94(8), 1149-1157 (2015-06-06)
Damage-associated molecular patterns (DAMPs), endogenous molecules released from injured or dying cells, evoke sterile inflammation that is not induced by microbial pathogens. Periodontal diseases are infectious diseases caused by oral microorganisms; however, in some circumstances, DAMPs might initiate inflammatory responses
René Weiss et al.
Antiviral research, 123, 93-104 (2015-09-15)
New anti-viral agents and strategies are urgently needed to fight rapidly mutating viruses, as vaccine programs cannot react fast enough to prevent pandemics. Recently, we have shown that interleukin-24 (IL-24) sensitizes tumor cells to toll-like receptor 3 (TLR3) mediated apoptosis.
A I Kajita et al.
The Journal of investigative dermatology, 135(8), 2005-2011 (2015-03-31)
Toll-like receptors (TLRs) recognize specific microbial products in the innate immune response. TLR3, a double-stranded RNA sensor, is thought to have an important role in viral infections, but the regulation of TLR3 expression and its function in keratinocytes are not

Questions

Reviews

No rating value

Active Filters

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique