Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU161031

Sigma-Aldrich

MISSION® esiRNA

targeting human RET

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCTGCATGAGAACAACTGGATCTGCATCCAGGAGGACACCGGCCTCCTCTACCTTAACCGGAGCCTGGACCATAGCTCCTGGGAGAAGCTCAGTGTCCGCAACCGCGGCTTTCCCCTGCTCACCGTCTACCTCAAGGTCTTCCTGTCACCCACATCCCTTCGTGAGGGCGAGTGCCAGTGGCCAGGCTGTGCCCGCGTATACTTCTCCTTCTTCAACACCTCCTTTCCAGCCTGCAGCTCCCTCAAGCCCCGGGAGCTCTGCTTCCCAGAGACAAGGCCCTCCTTCCGCATTCGGGAGAACCGACCCCCAGGCACCTTCCACCAGTTCCGCCTGCTGCCTGTGCAGTTCTTGTGCCCCAACATCAGCGTGGCCTACAGGCTCCTGGAGGGTGAGGGTCTGCCCTTCCGCTGCGCCCCGGACAGCCTGGAGGTGAGCACGCGCTGGGCCCTGGACCGCGAGCAGCGGGAGAAGTACGAGCTGGTGGC

Numéro d'accès Ensembl | humain

ENSG00000165731

Numéro d'accès NCBI

NM_020630

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... RET(5979) , RET(5979)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Kaustubh Bhinge et al.
Oncotarget, 8(16), 27155-27165 (2017-05-04)
Achaete-scute homolog 1 (ASCL1) is a neuroendocrine transcription factor specifically expressed in 10-20% of lung adenocarcinomas (AD) with neuroendocrine (NE) differentiation (NED). ASCL1 functions as an upstream regulator of the RET oncogene in AD with high ASCL1 expression (A+AD). RET
Hoon Ryu et al.
Laboratory investigation; a journal of technical methods and pathology, 91(3), 342-352 (2011-02-02)
Amyotrophic lateral sclerosis (ALS) is a fatal neurological disorder characterized by selective degeneration of motor neurons throughout the central nervous systems. Non-cell autonomous damage induced by glial cells is linked to the selective susceptibility of motor neurons in ALS, but
N Narita et al.
Oncogene, 28(34), 3058-3068 (2009-06-30)
RET proto-oncogene encodes a receptor tyrosine kinase whose ligand is glial cell line-derived neurotrophic factor (GDNF), and its polymorphism at G691S juxtamembrane region (RETp) is a germline polymorphism. Cutaneous melanomas, particularly the desmoplastic subtype, are highly neurotropic; thus we sought

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique