Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU157921

Sigma-Aldrich

MISSION® esiRNA

targeting human TFE3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTGAGGCTGCCCACACTACCGGCCCCACAGGCAGTGCGCCCAACAGCCCCATGGCGCTGCTCACCATCGGGTCCAGCTCAGAGAAGGAGATTGATGATGTCATTGATGAGATCATCAGCCTGGAGTCCAGTTACAATGATGAAATGCTCAGCTATCTGCCCGGAGGCACCACAGGACTGCAGCTCCCCAGCACGCTGCCTGTGTCAGGGAATCTGCTTGATGTGTACAGTAGTCAAGGCGTGGCCACACCAGCCATCACTGTCAGCAACTCCTGCCCAGCTGAGCTGCCCAACATCAAACGGGAGATCTCTGAGACCGAGGCAAAGGCCCTTTTGAAGGAACGGCAGAAGAAAGACAATCACAACCTAATTGAGCGTCGCAGGCGATTCAACATTAACGACAGGATCAAGGAACTGGGCACTCTCATCCCTAAGTCCAGTGACCCGGAG

Numéro d'accès Ensembl | humain

ENSG00000068323

Numéro d'accès NCBI

NM_006521

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... TFE3(7030) , TFE3(7030)

Catégories apparentées

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
QDV
IAV
BAV
SNS

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Nunzia Pastore et al.
The EMBO journal, 38(12) (2019-05-28)
Autophagy and energy metabolism are known to follow a circadian pattern. However, it is unclear whether autophagy and the circadian clock are coordinated by common control mechanisms. Here, we show that the oscillation of autophagy genes is dependent on the
Ikue Tai-Nagara et al.
Nature communications, 11(1), 6314-6314 (2020-12-11)
Blood and lymphatic vessels structurally bear a strong resemblance but never share a lumen, thus maintaining their distinct functions. Although lymphatic vessels initially arise from embryonic veins, the molecular mechanism that maintains separation of these two systems has not been
Na Zhang et al.
EBioMedicine, 40, 151-162 (2019-02-04)
Programmed death-ligand 1 (PD-L1) is a T-cell inhibitory checkpoint molecule that suppresses antitumor immunity. Anti-PD-L1 antibodies have shown remarkable promise in treating tumors, but the patient response rate is low. Therefore, small-molecule checkpoint inhibitors blocking PD-L1 function are urgently needed.
Chuanbin Yang et al.
Redox biology, 32, 101445-101445 (2020-02-11)
TFEB (transcription factor EB) and TFE3 (transcription factor E3) are "master regulators" of autophagy and lysosomal biogenesis. The stress response p38 mitogen-activated protein (MAP) kinases affect multiple intracellular responses including inflammation, cell growth, differentiation, cell death, senescence, tumorigenesis, and autophagy.
Leeanna El-Houjeiri et al.
Cell reports, 26(13), 3613-3628 (2019-03-28)
TFEB and TFE3 are transcriptional regulators of the innate immune response, but the mechanisms regulating their activation upon pathogen infection are poorly elucidated. Using C. elegans and mammalian models, we report that the master metabolic modulator 5'-AMP-activated protein kinase (AMPK) and

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique