Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU154771

Sigma-Aldrich

MISSION® esiRNA

targeting human SLCO2A1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGCTGCAGATCTTTGTGGACTATGGCAGGGTCAACACAGCTGCAGTTAACTTGGTCCCGGGTGACCCCCGATGGATTGGAGCCTGGTGGCTAGGCCTGCTCATTTCTTCAGCTTTATTGGTTCTCACCTCTTTCCCCTTTTTTTTCTTCCCTCGAGCAATGCCCATAGGAGCAAAGAGGGCTCCTGCCACAGCAGATGAAGCAAGGAAGTTGGAGGAGGCCAAGTCAAGAGGCTCCCTGGTGGATTTCATTAAACGGTTTCCATGCATCTTTCTGAGGCTCCTGATGAACTCACTCTTCGTCCTGGTGGTCCTGGCCCAGTGCACCTTCTCCTCCGTCATTGCTGGCCTCTCCACCTTCCTCAACAAGTTCCTGGAGAAGCAGTATGGCACCTCAGCAGCCTATGCCAACTTCCTCATTGGTGCT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Ahmad Yasser Hamdi Nor Azlan et al.
Saudi pharmaceutical journal : SPJ : the official publication of the Saudi Pharmaceutical Society, 28(11), 1420-1430 (2020-12-01)
Diabetic wounds are difficult to treat due to multiple causes, including reduced blood flow and bacterial infections. Reduced blood flow is associated with overexpression of prostaglandin transporter (PGT) gene, induced by hyperglycaemia which causing poor vascularization and healing of the
Antonio Madrigal-Martínez et al.
Journal of cellular physiology, 234(5), 7548-7559 (2018-10-28)
Cyclooxygenase (COX)-derived prostaglandin E2 (PGE2 ) affects many mechanisms that have been shown to play roles in carcinogenesis. Recently, we found that, in androgen-independent prostate cancer PC3 cells, PGE2 acts through an intracrine mechanism by which its uptake by the
Zhongbo Liu et al.
PloS one, 10(7), e0133615-e0133615 (2015-08-01)
Peripheral ischemia, resulting from diminished arterial flow and defective local vascularization, is one of the main causes of impaired wound healing in diabetes. Vasodilatory prostaglandins (PGs), including PGE2 and PGI2, regulate blood flow in peripheral tissues. PGs also stimulate angiogenesis

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique