Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU154611

Sigma-Aldrich

MISSION® esiRNA

targeting human KCNA3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGGTTCTCCTTCGAACTGCTGGTGCGGTTCTTCGCTTGTCCTAGCAAAGCCACCTTCTCGCGAAACATCATGAACCTGATCGACATTGTGGCCATCATTCCTTATTTTATCACTCTGGGTACCGAGCTGGCCGAACGACAGGGCAATGGACAGCAGGCCATGTCTCTGGCCATCCTGAGGGTCATCCGCCTGGTAAGGGTCTTCCGCATCTTCAAGCTGTCGCGCCACTCCAAGGGGCTGCAGATCCTCGGGCAAACGCTGAAGGCGTCCATGCGGGAGCTGGGATTGCTCATCTTCTTCCTCTTTATTGGGGTCATCCTTTTCTCCAGCGCGGTCTACTTTGCCGAGGCAGACGACCCCACTTCAGGTTTCAGCAGCATCCCGGATGCCTTCTGGTGGGCAGTGGTAACCATGACAACAGTGGGTTACGGCGATATGCACCCAGTGACCATAGGGGGCAAGATTGTGGGATCTCTCTGTGCCATCGCCGGTGTCTTGACCATCGCATTG

Numéro d'accès Ensembl | humain

ENSG00000177272

Numéro d'accès NCBI

NM_002232

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... KCNA3(3738) , KCNA3(3738)

Catégories apparentées

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Xiao-Hong Kan et al.
Archives of biochemistry and biophysics, 591, 150-156 (2016-01-10)
Ion channels expressed in macrophages have been tightly related to atherosclerosis by coupling cellular function. How the voltage-gated potassium channels (Kv) affect macrophage migration remain unknown. The aim of our study is to investigate whether Kv1.3-ERK signaling pathway plays an
Marat Khodoun et al.
Science advances, 6(47) (2020-11-20)
Lupus nephritis (LN) is an autoimmune disease with substantial morbidity/mortality and limited efficacy of available therapies. Memory T (Tm) lymphocytes infiltrate LN kidneys, contributing to organ damage. Analysis of LN, diabetic nephropathy, and healthy donor kidney biopsies revealed high infiltration
Roberta Peruzzo et al.
Redox biology, 37, 101705-101705 (2020-10-03)
The potassium channel Kv1.3, involved in several important pathologies, is the target of a family of psoralen-based drugs whose mechanism of action is not fully understood. Here we provide evidence for a physical interaction of the mitochondria-located Kv1.3 (mtKv1.3) and

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique