Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU151801

Sigma-Aldrich

MISSION® esiRNA

targeting human KLF4

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme

Sélectionner une taille de conditionnement

20 μG
192,00 €
50 μG
341,00 €

192,00 €

Veuillez contacter notre Service Clients pour connaître la disponibilité de ce produit.
Toutes les photos(1)

Sélectionner une taille de conditionnement

Changer de vue
20 μG
192,00 €
50 μG
341,00 €

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

192,00 €

Veuillez contacter notre Service Clients pour connaître la disponibilité de ce produit.

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGAAGGATCTCGGCCAATTTGGGGTTTTGGGTTTTGGCTTCGTTTCTTCTCTTCGTTGACTTTGGGGTTCAGGTGCCCCAGCTGCTTCGGGCTGCCGAGGACCTTCTGGGCCCCCACATTAATGAGGCAGCCACCTGGCGAGTCTGACATGGCTGTCAGCGACGCGCTGCTCCCATCTTTCTCCACGTTCGCGTCTGGCCCGGCGGGAAGGGAGAAGACACTGCGTCAAGCAGGTGCCCCGAATAACCGCTGGCGGGAGGAGCTCTCCCACATGAAGCGACTTCCCCCAGTGCTTCCCGGCCGCCCCTATGACCTGGCGGCGGCGACCGTGGCCACAGACCTGGAGAGCGGCGGAGCCGGTGCGGCTTGCGGCGGTAGCAACCTGGCGCCCCTACCTCGGAGAGAGACC

Numéro d'accès Ensembl | humain

ENSG00000136826

Numéro d'accès NCBI

NM_004235

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... KLF4(9314) , KLF4(9314)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
NAV
UTU
ITU
JQU
QCS

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Guodong Tang et al.
Oncotarget, 7(49), 81757-81767 (2016-11-12)
In this study, our findings indicated that FOXO1 expression frequently decreased in glioma tissues and cells. FOXO1 expression decrease correlated with glioma progression and predicted a worse overall survival of glioma patients. Restored FOXO1 expression inhibited glioma cells invasion and
Bing Li et al.
Human gene therapy, 30(3), 339-351 (2018-09-13)
Kallistatin (KS) has been recognized as a plasma protein with anti-inflammatory functions. Macrophages are the primary inflammatory cells in atherosclerotic plaques. However, it is unknown whether KS plays a role in macrophage development and the pathogenesis of atherosclerosis. This study
Scott Bell et al.
American journal of human genetics, 104(5), 815-834 (2019-04-30)
We identified individuals with variations in ACTL6B, a component of the chromatin remodeling machinery including the BAF complex. Ten individuals harbored bi-allelic mutations and presented with global developmental delay, epileptic encephalopathy, and spasticity, and ten individuals with de novo heterozygous
Takuya Nagata et al.
Breast cancer (Tokyo, Japan), 24(2), 326-335 (2016-06-15)
Prognosis of breast cancer patients has been reported to depend on the expression of induced pluripotent stem (iPS) cell-inducing factors: KLF4 and NANOG. However, the relationship between KLF4 or NANOG expression in each breast cancer subtype and the life prognosis
Muhammad Mushtaq et al.
Proceedings of the National Academy of Sciences of the United States of America, 117(27), 15673-15683 (2020-06-24)
Stemness encompasses the capability of a cell for self-renewal and differentiation. The stem cell maintains a balance between proliferation, quiescence, and regeneration via interactions with the microenvironment. Previously, we showed that ectopic expression of the mitochondrial ribosomal protein S18-2 (MRPS18-2)
Afficher tous les articles scientifiques apparentés

Questions

Reviews

No rating value

Active Filters

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique