Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU149911

Sigma-Aldrich

MISSION® esiRNA

targeting human CSPG4

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ACTACAGGGCACAAGGCTGTCAGATGGCCAGGGCTTCACCCAGGATGACATACAGGCTGGCCGGGTGACCTATGGGGCCACAGCACGTGCCTCAGAGGCAGTCGAGGACACCTTCCGTTTCCGTGTCACAGCTCCACCATATTTCTCCCCACTCTATACCTTCCCCATCCACATTGGTGGTGACCCAGATGCGCCTGTCCTCACCAATGTCCTCCTCGTGGTGCCTGAGGGTGGTGAGGGTGTCCTCTCTGCTGACCACCTCTTTGTCAAGAGTCTCAACAGTGCCAGCTACCTCTATGAGGTCATGGAGCGGCCCCGCCATGGGAGGTTGGCTTGGCGTGGGACACAGGACAAGACCACTATGGTGACATCCTTCACCAATGAAGACCTGTTGCGTGGCCGGCTGGTCTACCAGCATGATGACTCCGA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Jianbo Yang et al.
Melanoma research, 29(4), 365-375 (2019-05-30)
Chondroitin sulfate proteoglycan 4 (CSPG4) is a cell surface proteoglycan that enhances malignant potential in melanoma and several other tumor types. CSPG4 functions as a transmembrane scaffold in melanoma cells to activate oncogenic signaling pathways such as focal adhesion kinase
Sridevi Yadavilli et al.
Oncotarget, 6(14), 12141-12155 (2015-05-20)
Diffuse intrinsic pontine gliomas (DIPGs) have a dismal prognosis and are poorly understood brain cancers. Receptor tyrosine kinases stabilized by neuron-glial antigen 2 (NG2) protein are known to induce gliomagenesis. Here, we investigated NG2 expression in a cohort of DIPG
Frank Maus et al.
PloS one, 10(9), e0137311-e0137311 (2015-09-05)
The NG2 proteoglycan is characteristically expressed by oligodendrocyte progenitor cells (OPC) and also by aggressive brain tumours highly resistant to chemo- and radiation therapy. Oligodendrocyte-lineage cells are particularly sensitive to stress resulting in cell death in white matter after hypoxic

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique