Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU148811

Sigma-Aldrich

MISSION® esiRNA

targeting human SMN1, SMN2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCAGAGCGATGATTCTGACATTTGGGATGATACAGCACTGATAAAAGCATATGATAAAGCTGTGGCTTCATTTAAGCATGCTCTAAAGAATGGTGACATTTGTGAAACTTCGGGTAAACCAAAAACCACACCTAAAAGAAAACCTGCTAAGAAGAATAAAAGCCAAAAGAAGAATACTGCAGCTTCCTTACAACAGTGGAAAGTTGGGGACAAATGTTCTGCCATTTGGTCAGAAGACGGTTGCATTTACCCAGCTACCATTGCTTCAATTGATTTTAAGAGAGAAACCTGTGTTGTGGTTTACACTGGATATGGAAATAGAGAGGAGCAAAATCTGTCCGATCTACTTTCCCCAATCTGTGAAGTAGCTAATAATATAGAACAAAATGCTCAAGAGAATGAAAATGAAAGCCAAGTTTCA

Numéro d'accès Ensembl | humain

ENSG00000172062

Numéro d'accès NCBI

NM_022875

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... SMN1(6606) , SMN1(6606)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Hirotake Ichise et al.
PloS one, 11(3), e0150521-e0150521 (2016-03-08)
Phospholipase Cγ2 (PLCγ2)-deficient mice exhibit misconnections of blood and lymphatic vessels, and male infertility. However, the cell type responsible for vascular partitioning and the mechanism for male infertility remain unknown. Accordingly, we generated a mouse line that conditionally expresses endogenous
Thomas Koed Doktor et al.
Nucleic acids research, 45(1), 395-416 (2016-08-26)
Spinal Muscular Atrophy (SMA) is a neuromuscular disorder caused by insufficient levels of the Survival of Motor Neuron (SMN) protein. SMN is expressed ubiquitously and functions in RNA processing pathways that include trafficking of mRNA and assembly of snRNP complexes.
Adriana Roithová et al.
Nucleic acids research, 48(11), 6184-6197 (2020-05-07)
Spliceosomal small nuclear ribonucleoprotein particles (snRNPs) undergo a complex maturation pathway containing multiple steps in the nucleus and in the cytoplasm. snRNP biogenesis is strictly proofread and several quality control checkpoints are placed along the pathway. Here, we analyzed the
Isioma I Enwerem et al.
PloS one, 10(4), e0122348-e0122348 (2015-04-16)
Small nuclear ribonucleoproteins (snRNPs), which are required for pre-mRNA splicing, contain extensively modified snRNA. Small Cajal body-specific ribonucleoproteins (scaRNPs) mediate these modifications. It is unknown how the box C/D class of scaRNPs localizes to Cajal Bodies (CBs). The processing of
Janhavi Moharil et al.
PloS one, 10(10), e0141365-e0141365 (2015-10-28)
Stem cell differentiation involves multiple cascades of transcriptional regulation that govern the cell fate. To study the real-time dynamics of this complex process, quantitative and high throughput live cell assays are required. Herein, we developed a lentiviral library of promoters

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique