Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU145931

Sigma-Aldrich

MISSION® esiRNA

targeting human MARVELD2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGTTGCTGGATTAGCTTGGATCACCACCATTATTATTCTGGTTCTTGGCATGTCCATGTATTACCGGACCATTCTTCTGGACTCTAATTGGTGGCCCCTAACTGAATTTGGAATTAACGTTGCCTTGTTTATTTTGTATATGGCCGCAGCCATAGTCTATGTGAATGATACCAACCGAGGTGGCCTCTGCTACTATCCGTTATTTAATACACCAGTGAATGCAGTGTTCTGCCGGGTAGAAGGAGGACAGATAGCTGCAATGATCTTCCTGTTTGTCACCATGATAGTTTATCTCATTAGTGCTTTGGTTTGCCTAAAGTTATGGAGGCATGAGGCAGCTCGGAGACATAGAGAATATATGGAACAACAGGAGATAAATGAGCCATCATTGTCATCGAAAAGGAAAATGTGTGAAATGGCC

Numéro d'accès Ensembl | humain

ENSG00000152939

Numéro d'accès NCBI

NM_001038603

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... MARVELD2(153562) , MARVELD2(153562)

Catégories apparentées

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Timothy Smyth et al.
Particle and fibre toxicology, 17(1), 52-52 (2020-10-17)
While exposure to diesel exhaust particles has been linked to aberrant immune responses in allergic diseases such as asthma, little attention has been paid to their effects on the airway epithelial barrier. In this study, we sought to determine the
Susanne M Krug
Annals of the New York Academy of Sciences, 1397(1), 219-230 (2017-06-13)
The tricellular tight junction (tTJ) is a potential weak point of the paracellular barrier. For solving the proportional contribution of the tTJ, ion conductances and macromolecule permeabilities were analyzed in cell lines of different leakiness. MDCK II, Caco-2, and HT-29/B6
Lawrence C S Tam et al.
Scientific reports, 7, 40717-40717 (2017-01-17)
The juxtacanalicular connective tissue of the trabecular meshwork together with inner wall endothelium of Schlemm's canal (SC) provide the bulk of resistance to aqueous outflow from the anterior chamber. Endothelial cells lining SC elaborate tight junctions (TJs), down-regulation of which
S M Krug et al.
Mucosal immunology, 11(2), 345-356 (2017-06-15)
In the two inflammatory bowel diseases, ulcerative colitis (UC) and Crohn's disease (CD), altered expression of tight junction (TJ) proteins leads to an impaired epithelial barrier including increased uptake of luminal antigens supporting the inflammation. Here, we focused on regulation
Paul S Cassidy et al.
Molecular therapy. Methods & clinical development, 20, 86-94 (2020-12-31)
Systemic or localized application of glucocorticoids (GCs) can lead to iatrogenic ocular hypertension, which is a leading cause of secondary open-angle glaucoma and visual impairment. Previous work has shown that dexamethasone increases zonula occludens-1 (ZO-1) protein expression in trabecular meshwork

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique