Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU141291

Sigma-Aldrich

MISSION® esiRNA

targeting human ABL1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme

Sélectionner une taille de conditionnement

20 μG
192,00 €
50 μG
341,00 €

192,00 €


Veuillez contacter notre Service Clients pour connaître la disponibilité de ce produit.


Sélectionner une taille de conditionnement

Changer de vue
20 μG
192,00 €
50 μG
341,00 €

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

192,00 €


Veuillez contacter notre Service Clients pour connaître la disponibilité de ce produit.

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGGCAAGCTCTACGTCTCCTCCGAGAGCCGCTTCAACACCCTGGCCGAGTTGGTTCATCATCATTCAACGGTGGCCGACGGGCTCATCACCACGCTCCATTATCCAGCCCCAAAGCGCAACAAGCCCACTGTCTATGGTGTGTCCCCCAACTACGACAAGTGGGAGATGGAACGCACGGACATCACCATGAAGCACAAGCTGGGCGGGGGCCAGTACGGGGAGGTGTACGAGGGCGTGTGGAAGAAATACAGCCTGACGGTGGCCGTGAAGACCTTGAAGGAGGACACCATGGAGGTGGAAGAGTTCTTGAAAGAAGCTGCAGTCATGAAAGAGATCAAACACCCTAACCTGGTGCAGCTCCTTGGGGTCTGCACCCGGGAGCCCCCGTTCTATATCATCACTGAGTTCATGACCTACGGGAACCTCCT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... ABL1(25) , ABL1(25)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Stephen D S McCarthy et al.
Journal of acquired immune deficiency syndromes (1999), 82(4), 407-415 (2019-10-29)
Previous studies support dasatinib as a potent inhibitor of HIV-1 replication. However, a functional distinction between 2 kinase targets of the drug, ABL1 and ARG, has not been assessed. We used primary CD4 T-cells, CD8-depleted peripheral blood mononuclear cells (PBMCs)
Remant Kc et al.
Stem cells and development, 28(11), 734-744 (2018-12-27)
Nonviral gene therapy with specific short interfering RNAs (siRNAs) against BCR-Abl can be an alternative and/or supportive therapy of chronic myeloid leukemia (CML) with tyrosine kinase inhibitors (TKIs), given the often observed resistance to TKIs in clinical setting. In this
K C Remant et al.
Journal of biomedical materials research. Part A, 108(3), 565-580 (2019-11-13)
Synthetic siRNA technology has emerged as a promising approach for molecular therapy of cancer but, despite its potential for post-transcriptional gene silencing, there is an urgent need to develop efficient delivery systems particularly for difficult-to-transfect, anchorage-independent cells. In this study
X Wang et al.
Scientific reports, 8(1), 1002-1002 (2018-01-19)
Exploration of human pulmonary artery endothelial cell (EC) as a prototypical biomechanical system has important pathophysiologic relevance because this cell type plays a key role in the development of a wide variety of clinical conditions. The complex hierarchical organization ranging
Jun Hong et al.
Journal of Cancer, 11(20), 5867-5879 (2020-09-15)
Background: Esophageal adenocarcinoma (EAC) is highly aggressive and characterized by poor prognosis. AXL expression has been linked to Barrett's tumorigenesis and resistance to chemotherapy, which is associated with c-ABL intracellular localization. However, the molecular and functional relationship between AXL and

Articles

Quantitative and qualitative western blotting to validate knockdown by esiRNA.

Questions

Reviews

No rating value

Active Filters

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique