Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU140031

Sigma-Aldrich

MISSION® esiRNA

targeting human FGF18

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCTGCACTTGCCTGTGTTTACACTTCCTGCTGCTGTGCTTCCAGGTACAGGTGCTGGTTGCCGAGGAGAACGTGGACTTCCGCATCCACGTGGAGAACCAGACGCGGGCTCGGGACGATGTGAGCCGTAAGCAGCTGCGGCTGTACCAGCTCTACAGCCGGACCAGTGGGAAACACATCCAGGTCCTGGGCCGCAGGATCAGTGCCCGCGGCGAGGATGGGGACAAGTATGCCCAGCTCCTAGTGGAGACAGACACCTTCGGTAGTCAAGTCCGGATCAAGGGCAAGGAGACGGAATTCTACCTGTGCATGAACCGCAAAGGCAAGCTCGTGGGGAAGCCCGATGGCACCAGCAAGGAGTGTGTGTTCATCGAGAAGGTTCTGGAGAACAACTACACGGCCCTG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Jian Wu et al.
Cancer management and research, 12, 6767-6777 (2020-08-18)
The aim of this study was to evaluate whether estrogen promoted the proliferation and invasion of endometrial carcinoma (EC) cells through paracrine FGFs in endometrial stromal cells (ESCs). We screened gene alterations in a primary ESC culture after 10 nM
Jinglin Zhang et al.
Oncogene, 38(1), 33-46 (2018-08-08)
Fibroblast growth factors (FGFs) and their receptors are significant components during fundamental cellular processes. FGF18 plays a distinctive role in modulating the activity of both tumor cells and tumor microenvironment. This study aims to comprehensively investigate the expression and functional

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique