Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU137321

Sigma-Aldrich

MISSION® esiRNA

targeting human TBX21

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGGATGTTTGTGGACGTGGTCTTGGTGGACCAGCACCACTGGCGGTACCAGAGCGGCAAGTGGGTGCAGTGTGGAAAGGCCGAGGGCAGCATGCCAGGAAACCGCCTGTACGTCCACCCGGACTCCCCCAACACAGGAGCGCACTGGATGCGCCAGGAAGTTTCATTTGGGAAACTAAAGCTCACAAACAACAAGGGGGCGTCCAACAATGTGACCCAGATGATTGTGCTCCAGTCCCTCCATAAGTACCAGCCCCGGCTGCATATCGTTGAGGTGAACGACGGAGAGCCAGAGGCAGCCTGCAACGCTTCCAACACGCATATCTTTACTTTCCAAGAAACCCAGTTCATTGCCGTGACTGCCTACCAGAATGCCGAGATTACTCAGCTGAAAATTGATAATAACCCCTTTGCCAAAGGATTCCGGGAGAACT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Wenjing Yi et al.
Immunology, 150(3), 301-311 (2016-11-04)
Hepatitis C virus (HCV) induces a high rate of chronic infection via dysregulation of host immunity. We have previously shown that T-cell immunoglobulin and mucin domain protein-3 (Tim-3) is up-regulated on monocyte/macrophages (M/Mφ) during chronic HCV infection; little is known
Huiyong Peng et al.
Journal of immunology research, 2020, 6401978-6401978 (2020-05-08)
Long noncoding RNAs (lncRNAs) have been increasingly recognized as key immune molecules that participate in the pathogenesis of autoimmune diseases. Previous studies have demonstrated that the lncRNA Ifng-AS1, a key scaffold that contributes to the transcription of IFN-γ, depends on
Shigen Hayashi et al.
American journal of respiratory cell and molecular biology, 61(4), 525-536 (2019-04-10)
Chronic obstructive pulmonary disease (COPD) is a progressive lung disease characterized by peripheral airways inflammation and emphysema. Emerging evidence indicates a contribution of both innate and adaptive immune cells to the development of COPD. Transcription factor T-bet modulates the function
Jason S Weinstein et al.
The Journal of experimental medicine, 215(1), 337-355 (2017-12-08)
Follicular helper T (Tfh) cells promote germinal center (GC) B cell survival and proliferation and guide their differentiation and immunoglobulin isotype switching by delivering contact-dependent and soluble factors, including IL-21, IL-4, IL-9, and IFN-γ. IL-21 and IFN-γ are coexpressed by

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique