Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU135151

Sigma-Aldrich

MISSION® esiRNA

targeting human SMARCA2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ATCGAGGAAAAGCCAAACCTGTAGTGAGCGATTTTGACAGCGATGAGGAGCAGGATGAACGTGAACAGTCAGAAGGAAGTGGGACGGATGATGAGTGATCAGTATGGACCTTTTTCCTTGGTAGAACTGAATTCCTTCCTCCCCTGTCTCATTTCTACCCAGTGAGTTCATTTGTCATATAGGCACTGGGTTGTTTCTATATCATCATCGTCTATAAACTAGCTTTAGGATAGTGCCAGACAAACATATGATATCATGGTGTAAAAAACACACACATACACAAATATTTGTAACATATTGTGACCAAATGGGCCTCAAAGATTCAGATTGAAACAAACAAAAAGCTTTTGATGGAAAATATGTGGGTGGATAGTATATTTCTATGGGTGGGTCTAATTTGGTAACGGTTTGATTGTGCCTGGTTT

Numéro d'accès Ensembl | humain

ENSG00000080503

Numéro d'accès NCBI

NM_003070

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... SMARCA2(6595) , SMARCA2(6595)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Erika Zernickel et al.
Molecular cancer therapeutics, 18(3), 656-666 (2018-11-28)
Targeting of epigenetic regulators as the chromatin remodeler SWI/SNF is proving to be a promising therapeutic strategy for individualized treatment of cancer patients. Here, we tested whether targeting one of the two mutually exclusive subdomains of the SWI/SNF complex BRM/SMARCA2
Tharu M Fernando et al.
Nature communications, 11(1), 5551-5551 (2020-11-05)
Genomic studies performed in cancer patients and tumor-derived cell lines have identified a high frequency of alterations in components of the mammalian switch/sucrose non-fermentable (mSWI/SNF or BAF) chromatin remodeling complex, including its core catalytic subunit, SMARCA4. Cells exhibiting loss of
Qiong Wu et al.
Journal of cellular physiology, 230(11), 2683-2694 (2015-03-27)
The Brahma (BRM) and Brahma-related Gene 1 (BRG1) ATPases are highly conserved homologs that catalyze the chromatin remodeling functions of the multi-subunit human SWI/SNF chromatin remodeling enzymes in a mutually exclusive manner. SWI/SNF enzyme subunits are mutated or missing in

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique