Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU129811

Sigma-Aldrich

MISSION® esiRNA

targeting human GATA6

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCCAACTGTCACACCACAACTACCACCTTATGGCGCAGAAACGCCGAGGGTGAACCCGTGTGCAATGCTTGTGGACTCTACATGAAACTCCATGGGGTGCCCAGACCACTTGCTATGAAAAAAGAGGGAATTCAAACCAGGAAACGAAAACCTAAGAACATAAATAAATCAAAGACTTGCTCTGGTAATAGCAATAATTCCATTCCCATGACTCCAACTTCCACCTCTTCTAACTCAGATGATTGCAGCAAAAATACTTCCCCCACAACACAACCTACAGCCTCAGGGGCGGGTGCCCCGGTGATGACTGGTGCGGGAGAGAGCACCAATCCCGAGAACAGCGAGCTCAAGTATTCGGGTCAAGATGGGCTCTACATAGGCGTCAGTCTCGCCTCGCCGGCCGAAGTCACGTCCTCCGTGCGACCGGATTCCTGGTGCGCCCTGGCCCTGGCCTGAGCCCACGCCGCCAGGAGGCAGGGAGGGCTCCGCCGCGGGCCTCACTCCACTCGTGTCTGCTTTTG

Numéro d'accès Ensembl | humain

ENSG00000141448

Numéro d'accès NCBI

NM_005257

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... GATA6(2627) , GATA6(2627)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Ruishuang Ma et al.
Cancer biology & therapy, 20(9), 1206-1212 (2019-05-17)
Autophagy plays a complicated role in tumorigenesis, and the effects of autophagy in drug resistance have not been fully known. The aim of this study was to evaluate autophagy activity in lung cancer cells derived from different origins and explore
Mao Guoping et al.
Oncology research, 26(7), 1023-1029 (2018-01-13)
Recent studies have suggested that the dysregulation of microRNAs (miRNAs) plays a critical role in the progression of human cancers, including gastric cancer (GC). miR-143 had been reported to function as a tumor suppressor in GC. However, the exact molecular
Chellappagounder Thangavel et al.
The American journal of pathology, 189(4), 847-867 (2019-02-02)
Caveolins (CAVs) are structural proteins of caveolae that function as signaling platforms to regulate smooth muscle contraction. Loss of CAV protein expression is associated with impaired contraction in obstruction-induced bladder smooth muscle (BSM) hypertrophy. In this study, microarray analysis of
Mio Nakanishi et al.
Cell, 177(4), 910-924 (2019-04-16)
The assembly of organized colonies is the earliest manifestation in the derivation or induction of pluripotency in vitro. However, the necessity and origin of this assemblance is unknown. Here, we identify human pluripotent founder cells (hPFCs) that initiate, as well as
Holly Brunton et al.
Cell reports, 31(6), 107625-107625 (2020-05-14)
Pancreatic ductal adenocarcinoma (PDAC) can be divided into transcriptomic subtypes with two broad lineages referred to as classical (pancreatic) and squamous. We find that these two subtypes are driven by distinct metabolic phenotypes. Loss of genes that drive endodermal lineage

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique