Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU129521

Sigma-Aldrich

MISSION® esiRNA

targeting human CXCL12

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGAGCCAACGTCAAGCATCTCAAAATTCTCAACACTCCAAACTGTGCCCTTCAGATTGTAGCCCGGCTGAAGAACAACAACAGACAAGTGTGCATTGACCCGAAGCTAAAGTGGATTCAGGAGTACCTGGAGAAAGCTTTAAACAAGTAAGCACAACAGCCAAAAAGGACTTTCCGCTAGACCCACTCGAGGAAAACTAAAACCTTGTGAGAGATGAAAGGGCAAAGACGTGGGGGAGGGGGCCTTAACCATGAGGACCAGGTGTGTGTGTGGGGTGGGCACATTGATCTGGGATCGGGCCTGAGGTTTGCCAGCATTTAGACCCTGCATTTATAGCATACGGTATGATATTGCAGCTTATATTCATCCATGCCCTGTACCTGTGCACGTTGGAACTTTTATTACTGGGGTTTTTCTAAGAAAGAAATTGTATTATCAACAGCATTTTCAAGCAGTTAGTTCCTTCATGATCATCACAATCATCATCATTCTCATTCTCATTTTTTAAATCAACGAGTACTTCAAGATCTGAATTTGGCTTGTTTGGAGC

Numéro d'accès Ensembl | humain

ENSG00000107562

Numéro d'accès NCBI

NM_000609

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... CXCL12(6387) , CXCL12(6387)

Catégories apparentées

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Kangling Xie et al.
American journal of physiology. Cell physiology, 319(3), C579-C588 (2020-07-02)
Identification of specific biomarkers for ischemic stroke is necessary due to their abilities to improve treatment outcomes. Many studies have demonstrated the involvement of microRNAs (miRNAs) in the pathogenesis and complications of ischemic stroke and patient outcomes. We found that
Timo Rademakers et al.
Scientific reports, 7, 45263-45263 (2017-03-30)
During plaque progression, inflammatory cells progressively accumulate in the adventitia, paralleled by an increased presence of leaky vasa vasorum. We here show that next to vasa vasorum, also the adventitial lymphatic capillary bed is expanding during plaque development in humans
Xiaoming Zhu et al.
Experimental cell research, 375(2), 41-50 (2019-01-07)
Cancer-associated fibroblasts (CAFs) play critical roles in tumor progression. However, the role and mechanism underlying CAFs in esophageal cancer (EC) remain unclear. In this study, primary CAFs and normal esophageal fibroblasts (NOFs) were isolated and characterized by immunofluorescence, qRT-PCR and
Guan-Xi Liu et al.
Brain, behavior, and immunity, 84, 72-79 (2019-11-22)
Conditioned place preference (CPP) is a learned behavior, in which animals learn to associate environmental contexts with rewarding effects. The formation of CPP is an integrated outcome of multiple learning processes. Although multiple anatomical substrates underlying this contextual learning have
S J Han et al.
Cell death & disease, 6, e1863-e1863 (2015-08-28)
High-mobility group box 1 (HMGB1) functions as a transcription-enhancing nuclear protein as well as a crucial cytokine that regulates inflammation. This study demonstrated that secretion of HMGB1 due to ultraviolet (UV) radiation inducing ocular surface inflammation-mediated reactive oxygen species (ROS)

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique