Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU126851

Sigma-Aldrich

MISSION® esiRNA

targeting human CCR5

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GTGTGATCACTTGGGTGGTGGCTGTGTTTGCGTCTCTCCCAGGAATCATCTTTACCAGATCTCAAAAAGAAGGTCTTCATTACACCTGCAGCTCTCATTTTCCATACAGTCAGTATCAATTCTGGAAGAATTTCCAGACATTAAAGATAGTCATCTTGGGGCTGGTCCTGCCGCTGCTTGTCATGGTCATCTGCTACTCGGGAATCCTAAAAACTCTGCTTCGGTGTCGAAATGAGAAGAAGAGGCACAGGGCTGTGAGGCTTATCTTCACCATCATGATTGTTTATTTTCTCTTCTGGGCTCCCTACAACATTGTCCTTCTCCTGAACACCTTCCAGGAATTCTTTGGCCTGAATAATTGCAGTAGCTCTAACAGGTTGGACCAAGCTATGCAGGTGACAGAGACTCTTGGGATGACGCACTGCTGCATCAACCCCATCATCTATGCCTTTGTCGGGGAGAAGTTCAG

Numéro d'accès Ensembl | humain

ENSG00000160791

Numéro d'accès NCBI

NM_000579

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... CCR5(1234) , CCR5(1234)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Ying Wang et al.
Oncology reports, 36(6), 3522-3528 (2016-10-18)
Glioblastoma (GBM) is a highly malignant brain tumor characterized by invasion tendency. Macrophage infiltration is associated with GBM invasion, but the mechanisms remain unclear. Hypoxia is an outstanding characteristic of GBM tissue. Hypoxia microenvironment modulates the biological behaviors of both tumor
Silvia Waldeck et al.
Molecular oncology, 14(4), 779-794 (2020-01-20)
FLT3-ITD tyrosine kinase inhibitors (TKI) show limited clinical activity in acute myeloid leukemia (AML) due to emerging resistance. TKI resistance is mediated by secondary FLT3-ITD mutations only in a minority of cases. We hypothesize that the cytokine CCL5 protects AML
Asim Pervaiz et al.
Journal of cancer research and clinical oncology, 147(1), 73-91 (2020-09-10)
Liver metastasis is observed in up to 50% of colorectal cancer (CRC) patients. Available treatment options are limited and disease recurrence is often. Chemokine receptor 5 (CCR5) has attracted attention as novel therapeutic target for treating cancers. In this study
Takayuki Kodama et al.
Laboratory investigation; a journal of technical methods and pathology, 100(9), 1140-1157 (2020-05-28)
Tumor-associated macrophages (TAMs) contribute to the progression and mortality of various malignancies. We reported that high numbers of infiltrating TAMs were significantly associated with tumor progression and poor prognosis in esophageal squamous cell carcinoma (ESCC). In our previous investigation of
Seyeon Oh et al.
Marine drugs, 18(8) (2020-07-31)
Hyperlipidemia induces vascular smooth muscle cell (VSMC) proliferation and phenotype switching from contractile to synthetic. This process is involved in arterial remodeling via the chemokine ligand 5 (CCL5)/chemokine receptor 5 (CCR5) pathway. Arterial remodeling is related to atherosclerosis or intimal
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique