Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU126361

Sigma-Aldrich

MISSION® esiRNA

targeting human SERPINB5

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGCAAATGAAATTGGACAGGTTCTTCATTTTGAAAATGTCAAAGATGTACCCTTTGGATTTCAAACAGTAACATCGGATGTAAACAAACTTAGTTCCTTTTACTCACTGAAACTAATCAAGCGGCTCTACGTAGACAAATCTCTGAATCTTTCTACAGAGTTCATCAGCTCTACGAAGAGACCGTATGCAAAGGAATTGGAAACTGTTGACTTCAAAGATAAATTGGAAGAAACGAAAGGTCAGATCAACAACTCAATTAAGGATCTCACAGATGGCCACTTTGAGAACATTTTAGCTGACAACAGTGTGAACGACCAGACCAAAATCCTTGTGGTTAATGCTGCCTACTTTGTTGGCAAGTGGATGAAGAAATTTTCTGAATCAGAAACAAAAGAATGTCCTTTCAGAGTCAACAAGACAGACACCAAACCAGTGCAGATGATGAACATGGAGGCC

Numéro d'accès Ensembl | humain

ENSG00000206075

Numéro d'accès NCBI

NM_002639

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... SERPINB5(5268) , SERPINB5(5268)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Feng Qiu et al.
Bioscience, biotechnology, and biochemistry, 82(8), 1366-1376 (2018-04-17)
The aim of the present study is to investigate the role of miR-21-5p in angiogenesis of human retinal microvascular endothelial cells (HRMECs). HRMECs were incubated with 5 mM glucose, 30 mM glucose or 30 mM mannitol for 24 h, 48 h or 72 h. Then, HRMECs
Ning Wang et al.
Human cell, 33(3), 663-675 (2020-05-16)
This study aims to investigate how Maspin affects the EMT and angiogenesis of gastric cancer (GC) cells via ITGB1/FAK pathway. Immunohistochemistry was used to evaluate the expressions of Maspin, ITGB1, FAK, E-cadherin, Vimentin, D2-40, and CD34 in GC and adjacent
Chikako Takeda et al.
Diagnostic pathology, 9, 205-205 (2014-11-02)
Maspin is a 42 kDa protein known to act as a tumor suppressor. Although its function has not been fully elucidated, numerous reports have investigated the prognostic impact of maspin in patients with several types of cancer. However, there have
Bo Mi Ku et al.
PloS one, 13(4), e0194730-e0194730 (2018-04-12)
AZD9291 (osimertinib) is approved for standard care in patients with EGFR T790M-positive non-small cell lung cancer (NSCLC) after prior EGFR TKI progression. Furthermore, AZD9291 is now being evaluated as a first-line treatment for NSCLC patients with activation EGFR mutations. Based
Yu-Hsiang Lin et al.
Cancers, 12(1) (2019-12-22)
Maspin is a member of the clade B serine protease inhibitor superfamily and exhibits diverse regulatory effects in various types of solid tumors. We compared the expressions of maspin and determined its potential biological functions and regulatory mechanisms in bladder
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique