Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU121641

Sigma-Aldrich

MISSION® esiRNA

targeting human FZD7

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCTGGCCTGCTACTTCTACGAGCAGGCCTTCCGCGAGCACTGGGAGCGCACCTGGCTCCTGCAGACGTGCAAGAGCTATGCCGTGCCCTGCCCGCCCGGCCACTTCCCGCCCATGAGCCCCGACTTCACCGTCTTCATGATCAAGTACCTGATGACCATGATCGTCGGCATCACCACTGGCTTCTGGATCTGGTCGGGCAAGACCCTGCAGTCGTGGCGCCGCTTCTACCACAGACTTAGCCACAGCAGCAAGGGGGAGACTGCGGTATGAGCCCCGGCCCCTCCCCACCTTTCCCACCCCAGCCCTCTTGCAAGAGGAGAGGCACGGTAGGGAAAAGAACTGCTGGGTGGGGGCCTGTTTCTGTAACTTTCTCCCCCTCTACTGAGAAGTGACCTGGAAGTGAGAAGTTCTTTGCAGATTTGGGGCGAGGGGTGATTTGGAAAAGAAGACCTGGGTG

Numéro d'accès Ensembl | humain

ENSG00000155760

Numéro d'accès NCBI

NM_003507

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... FZD7(8324) , FZD7(8324)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yufeng Wang et al.
Cell death & disease, 9(9), 851-851 (2018-08-30)
Previous evidences reveal that long non-coding RNA (lncRNA) down syndrome critical region 8 (DSCR8) involves in the progression of multiple cancers. However, the exact expression, function, and mechanism of DSCR8 in hepatocellular carcinoma (HCC) remain uncovered. In this study, real-time
Yan Geng et al.
Oncology reports, 35(4), 2441-2450 (2016-01-20)
MicroRNAs (miRNAs) are novel tools for cancer therapy. Frizzled7 (FZD7) is an important co-receptor in the WNT signaling pathway. The WNT signaling pathway is aberrantly activated in Helicobacter pylori (H. pylori)‑infected gastric cancer cells. However, the role of FZD7 in
M Asad et al.
Cell death & disease, 5, e1346-e1346 (2014-07-18)
Ovarian cancer (OC) can be classified into five biologically distinct molecular subgroups: epithelial-A (Epi-A), Epi-B, mesenchymal (Mes), Stem-A and Stem-B. Among them, Stem-A expresses genes relating to stemness and is correlated with poor clinical prognosis. In this study, we show
Salvatore Condello et al.
Cancer research, 78(11), 2990-3001 (2018-03-08)
Cancer progression and recurrence are linked to a rare population of cancer stem cells (CSC). Here, we hypothesized that interactions with the extracellular matrix drive CSC proliferation and tumor-initiating capacity and investigated the functions of scaffold protein tissue transglutaminase (TG2)
Liang-Jie Wang et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(1), 314-326 (2018-07-07)
Migration of placental extravillous trophoblast (EVT) cells into uterine decidua facilitates the establishment of blood circulation between mother and fetus and is modulated by EVT-decidual cell interaction. Poor or excessive EVT migration is associated with pregnancy complications such as preeclampsia
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique