Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU109121

Sigma-Aldrich

MISSION® esiRNA

targeting human GBA

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CAGCCCATGTTCTACCACCTTGGCCACTTCAGCAAGTTCATTCCTGAGGGCTCCCAGAGAGTGGGGCTGGTTGCCAGTCAGAAGAACGACCTGGACGCAGTGGCACTGATGCATCCCGATGGCTCTGCTGTTGTGGTCGTGCTAAACCGCTCCTCTAAGGATGTGCCTCTTACCATCAAGGATCCTGCTGTGGGCTTCCTGGAGACAATCTCACCTGGCTACTCCATTCACACCTACCTGTGGCGTCGCCAGTGATGGAGCAGATACTCAAGGAGGCACTGGGCTCAGCCTGGGCATTAAAGGGACAGAGTCAGCTCACACGCTGTCTGTGACTAAAGAGGGCACAGCAGGGCCAGTGTGAGCTTACAGCGACGTAAGCCCAGGGGCAATGGTTTGGGTGACTCACTTTCCC

Numéro d'accès Ensembl | humain

ENSG00000177628

Numéro d'accès NCBI

NM_000157

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... GBA(2629) , GBA(2629)

Catégories apparentées

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Tiziana Squillaro et al.
Journal of cellular physiology, 232(12), 3454-3467 (2017-01-18)
Lysosomal storage disorders (LDS) comprise a group of rare multisystemic diseases resulting from inherited gene mutations that impair lysosomal homeostasis. The most common LSDs, Gaucher disease (GD), and Fabry disease (FD) are caused by deficiencies in the lysosomal glucocerebrosidase (GBA)
Kecheng Zhou et al.
The American journal of pathology, 190(10), 2018-2028 (2020-07-18)
Studies of lysosome associated protein transmembrane 4B (LAPTM4B) have mainly focused on the 35-kDa isoform and its association with poor prognosis in cancers. Here, by employing a novel monoclonal antibody, the authors found that the 24-kDa LAPTM4B isoform predominated in
Jong-Won Lim et al.
Human molecular genetics, 24(17), 4817-4828 (2015-06-05)
Facioscapulohumeral muscular dystrophy (FSHD) is caused by the aberrant expression of the DUX4 transcription factor in skeletal muscle. The DUX4 retrogene is encoded in the D4Z4 macrosatellite repeat array, and smaller array size or a mutation in the SMCHD1 gene

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique