Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU108861

Sigma-Aldrich

MISSION® esiRNA

targeting human IGF2BP3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme

Sélectionner une taille de conditionnement

20 μG
192,00 €
50 μG
341,00 €

192,00 €

Veuillez contacter notre Service Clients pour connaître la disponibilité de ce produit.
Toutes les photos(1)

Sélectionner une taille de conditionnement

Changer de vue
20 μG
192,00 €
50 μG
341,00 €

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

192,00 €

Veuillez contacter notre Service Clients pour connaître la disponibilité de ce produit.

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TCTATCAGTCGGTGCCATCATCGGCAAGCAGGGCCAGCACATCAAGCAGCTTTCTCGCTTTGCTGGAGCTTCAATTAAGATTGCTCCAGCGGAAGCACCAGATGCTAAAGTGAGGATGGTGATTATCACTGGACCACCAGAGGCTCAGTTCAAGGCTCAGGGAAGAATTTATGGAAAAATTAAAGAAGAAAACTTTGTTAGTCCTAAAGAAGAGGTGAAACTTGAAGCTCATATCAGAGTGCCATCCTTTGCTGCTGGCAGAGTTATTGGAAAAGGAGGCAAAACGGTGAATGAACTTCAGAATTTGTCAAGTGCAGAAGTTGTTGTCCCTCGTGACCAGACACCTGATGAGAATGACCAAGTGGTTGTCAAAATAACTGGTCACTTCTATGCTTGCCAGGTTGCCCAGAGAAAAATTCAGGAAATTCTGACTCAGGTAAAGCAGCACCAACAACAGAAGGCTCTGCAAAGTGGAC

Numéro d'accès Ensembl | humain

ENSG00000136231

Numéro d'accès NCBI

NM_006547

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... IGF2BP3(10643) , IGF2BP3(10643)

Catégories apparentées

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
QCS
CWS
ITS

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Huidi Liu et al.
Frontiers in oncology, 9, 1570-1570 (2020-02-23)
Ovarian Clear Cell Carcinoma (OCCC) displays distinctive clinical and molecular characteristics and confers the worst prognosis among all ovarian carcinoma histotypes when diagnosed at advanced stage, because of the lack of effective therapy. IGF2BP3 is an RNA binding protein that
Yonglei Liu et al.
Journal of cellular and molecular medicine, 21(9), 1979-1988 (2017-05-20)
CD44, a cell adhesion protein, involves in various process in cancer such as cell survival and metastasis. Most researches on CD44 in cancer focus on cancer cells. Recently, it is found that CD44 expression is high in fibroblasts of tumour
Douglas Hanniford et al.
Cancer cell, 37(1), 55-70 (2020-01-15)
Metastasis is the primary cause of death of cancer patients. Dissecting mechanisms governing metastatic spread may uncover important tumor biology and/or yield promising therapeutic insights. Here, we investigated the role of circular RNAs (circRNA) in metastasis, using melanoma as a

Questions

Reviews

No rating value

Active Filters

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique