Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU104281

Sigma-Aldrich

MISSION® esiRNA

targeting human PHB2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme

Sélectionner une taille de conditionnement

20 μG
192,00 €
50 μG
341,00 €

192,00 €


Veuillez contacter notre Service Clients pour connaître la disponibilité de ce produit.


Sélectionner une taille de conditionnement

Changer de vue
20 μG
192,00 €
50 μG
341,00 €

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

192,00 €


Veuillez contacter notre Service Clients pour connaître la disponibilité de ce produit.

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TTGTCAACGAGGTGCTCAAGAGTGTGGTGGCCAAGTTCAATGCCTCACAGCTGATCACCCAGCGGGCCCAGGTATCCCTGTTGATCCGCCGGGAGCTGACAGAGAGGGCCAAGGACTTCAGCCTCATCCTGGATGATGTGGCCATCACAGAGCTGAGCTTTAGCCGAGAGTACACAGCTGCTGTAGAAGCCAAACAAGTGGCCCAGCAGGAGGCCCAGCGGGCCCAATTCTTGGTAGAAAAAGCAAAGCAGGAACAGCGGCAGAAAATTGTGCAGGCCGAGGGTGAGGCCGAGGCTGCCAAGATGCTTGGAGAAGCACTGAGCAAGAACCCTGGCTACATCAAACTTCGCAAGATTCGAGCAGCCCAGAATATCTCCAAGACGATCGCCACATCACAGAATCGTATCTATCTCACAGCTGACAACCTTGTGCTGAACCTACAGGATGAAAGTTTCACCAGGTACAGTGACAGCCTCATCAAGGGT

Numéro d'accès Ensembl | humain

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Tongyu Zhang et al.
Stroke, 50(4), 978-988 (2019-03-21)
Background and Purpose- Mitoquinone has been reported as a mitochondria-targeting antioxidant to promote mitophagy in various chronic diseases. Here, our aim was to study the role of mitoquinone in mitophagy activation and oxidative stress-induced neuronal death reduction after subarachnoid hemorrhage
Heng-Hsiung Wu et al.
Journal of food and drug analysis, 28(1), 183-194 (2019-12-31)
Membranous nephropathy (MN) is the most common cause of nephrotic syndrome in adults, when not effectively treated. The aim of this study was to discover new targets for the diagnosis and treatment of MN. A reliable mouse model of MN
Ting Huang et al.
Frontiers in immunology, 11, 569173-569173 (2020-10-30)
Mitophagy has recently been implicated in bacterial infection but the underlying mechanism remains largely unknown. Here, we uncover a role of microRNA-302/367 cluster in regulating mitophagy and its associated host response against bacterial infection. We demonstrate that miR-302/367 cluster expression
Cristina Moncunill-Massaguer et al.
Oncotarget, 6(39), 41750-41765 (2015-10-27)
We previously described diaryl trifluorothiazoline compound 1a (hereafter referred to as fluorizoline) as a first-in-class small molecule that induces p53-independent apoptosis in a wide range of tumor cell lines. Fluorizoline directly binds to prohibitin 1 and 2 (PHBs), two proteins

Questions

Reviews

No rating value

Active Filters

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique