Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU100211

Sigma-Aldrich

MISSION® esiRNA

targeting human ZMYND8

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TTTGAAGGAGCTGAGCGAGTCGGTCCAGCAACAGTCCACCCCTGTTCCTCTCATCTCTCCCAAGCGCCAGATTCGTAGCAGGTTCCAGCTGAATCTTGACAAGACCATAGAGAGTTGCAAAGCACAATTAGGCATAAATGAAATCTCGGAAGATGTCTATACGGCCGTAGAGCACAGCGATTCGGAGGATTCTGAGAAGTCAGATAGTAGCGATAGTGAGTATATCAGTGATGATGAGCAGAAGTCTAAGAACGAGCCAGAAGACACAGAGGACAAAGAAGGTTGTCAGATGGACAAAGAGCCATCTGC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Shravanti Mukherjee et al.
Cell death & disease, 11(12), 1073-1073 (2020-12-17)
The major challenge in chemotherapy lies in the gain of therapeutic resistance properties of cancer cells. The relatively small fraction of chemo-resistant cancer cells outgrows and are responsible for tumor relapse, with acquired invasiveness and stemness. We demonstrate that zinc-finger
Moitri Basu et al.
Biochimica et biophysica acta, 1860(4), 450-459 (2017-02-25)
All trans retinoic acid (ATRA), an active vitamin-A derivative, has been shown to regulate gene expression program and thus imparts anti-proliferative activity to cancer cells. Previously, we identified a dual histone reader ZMYND8 (zinc finger MYND (Myeloid, Nervy and DEAF-1)-type
Moitri Basu et al.
The Biochemical journal, 474(11), 1919-1934 (2017-04-23)
Enhanced migratory potential and invasiveness of cancer cells contribute crucially to cancer progression. These phenotypes are achieved by precise alteration of invasion-associated genes through local epigenetic modifications which are recognized by a class of proteins termed a chromatin reader. ZMYND8

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique