Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU099991

Sigma-Aldrich

MISSION® esiRNA

targeting human CAPN3, RP11-164J13.1 (1)

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GATGATGGCACGAACATGACCTATGGAACCTCTCCTTCTGGTCTGAACATGGGGGAGTTGATTGCACGGATGGTAAGGAATATGGATAACTCACTGCTCCAGGACTCAGACCTCGACCCCAGAGGCTCAGATGAAAGACCGACCCGGACAATCATTCCGGTTCAGTATGAGACAAGAATGGCCTGCGGGCTGGTCAGAGGTCACGCCTACTCTGTCACGGGGCTGGATGAGGTCCCGTTCAAAGGTGAGAAAGTGAAGCTGGTGCGGCTGCGGAATCCGTGGGGCCAGGTGGAGTGGAACGGTTCTTGGAG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Ivone de Andrade Rosa et al.
Tissue & cell, 67, 101436-101436 (2020-09-16)
CAPN3 is a muscle-specific and an intrinsically disordered protein. Thus, as a scaffolding protein CAPN3 could play a role during early stages of myogenesis. To test this hypothesis, we studied the distribution and function of CAPN3 during myogenesis using embryonic
Ting Tao et al.
Cell research, 23(5), 620-634 (2013-01-30)
p53 protein turnover through the ubiquitination pathway is a vital mechanism in the regulation of its transcriptional activity; however, little is known about p53 turnover through proteasome-independent pathway(s). The digestive organ expansion factor (Def) protein is essential for the development

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique