Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU096281

Sigma-Aldrich

MISSION® esiRNA

targeting human ATXN1 (1)

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCAGCACTTTGACTGCTCTGGAGTAGGGTTGTACAATTTCAAGGAATGTTTGGATTTCCTGCATCTTGTGGATTACTCCTTAGATACCGCATAGATTGCAATATAATGCTGCATGTTCAAGATGAACAGTAGCTCCTAGTAATCATAAAATCCACTCTTTGCACAGTTTGATCTTTACTGAAATATGTTGCCAAAATTTATTTTTGTTGTTGTAGCTCTGGATTTTGTTTTGTTTTGTTTTTTAAGGAAACGATTGACAATACCCTTTAACATCTGTGACTACTAAGGAAACCTATTTCTTTCATAGAGAGAAAAATCTCCAATGCTTTTGAAGACA

Numéro d'accès Ensembl | humain

ENSG00000124788

Numéro d'accès NCBI

NM_000332

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... ATXN1(6310) , ATXN1(6310)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

A-Ram Kang et al.
Oncotarget, 8(11), 18248-18259 (2017-02-18)
The mutant form of the protein ataxin-1 (ATXN1) causes the neurodegenerative disease spinocerebellar ataxia type-1. Recently, ATXN1 was reported to enhance E-cadherin expression in the breast cancer cell line MCF-7, suggesting a potential association between ATXN1 and cancer development. In
Larissa Nitschke et al.
Genes & development, 34(17-18), 1147-1160 (2020-08-09)
Identifying modifiers of dosage-sensitive genes involved in neurodegenerative disorders is imperative to discover novel genetic risk factors and potential therapeutic entry points. In this study, we focus on Ataxin-1 (ATXN1), a dosage-sensitive gene involved in the neurodegenerative disease spinocerebellar ataxia
Yuka Sugihara et al.
PloS one, 14(5), e0217394-e0217394 (2019-05-29)
Recently, we showed that imidazole dipeptide such as carnosine contained abundantly in chicken breast meat improves brain function in a double-blind randomized controlled trial. However, the underlying molecular mechanisms remain unknown. Here, we investigated whether carnosine activates intestinal epithelial cells

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique