Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU094941

Sigma-Aldrich

MISSION® esiRNA

targeting human HNRNPD (1)

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTTGCCGAAATTGAGGACATGATTAAAATTGCAGTGAAGTTTGAAATGTTTTTAGCAAAATCTAATTTTTGCCATAATGTGTCCTCCCTGTCCAAATTGGGAATGACTTAATGTCAATTTGTTTGTTGGTTGTTTTAATAATACTTCCTTATGTAGCCATTAAGATTTATATGAATATTTTCCCAAATGCCCAGTTTTTGCTTAATATGTATTGTGCTTTTTAGAACAAATCTGGATAAATGTGCAAAAGTACCCCTTTGCACAGATAGTTAATGTTTTATGCTTCCATTAAATAAAAAGGACTTAAAATCTGTTAATTATAATAGAAATGCGGCTAGTTCAGAGAGA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Shuhong Sun et al.
The Journal of biological chemistry, 291(50), 25823-25836 (2016-10-28)
Autotaxin (ATX) is a key enzyme that converts lysophosphatidylcholine (LPC) into lysophosphatidic acid (LPA), a lysophospholipid mediator that regulates cellular activities through its specific G protein-coupled receptors. The ATX-LPA axis plays an important role in various physiological and pathological processes
Luigi Alfano et al.
Nucleic acids research, 47(8), 4068-4085 (2019-02-26)
DNA double strand break (DSB) repair through homologous recombination (HR) is crucial to maintain genome stability. DSB resection generates a single strand DNA intermediate, which is crucial for the HR process. We used a synthetic DNA structure, mimicking a resection
Huiwen Song et al.
Autophagy, 15(8), 1419-1437 (2019-03-15)
N6-methyladenosine (m6A) mRNA modifications play critical roles in various biological processes. However, no study addresses the role of m6A in macroautophagy/autophagy. Here, we show that m6A modifications are increased in H/R-treated cardiomyocytes and ischemia/reperfusion (I/R)-treated mice heart. We found that

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique