Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU094851

Sigma-Aldrich

MISSION® esiRNA

targeting human APBB3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme

Sélectionner une taille de conditionnement

20 μG
192,00 €
50 μG
341,00 €

192,00 €


Veuillez contacter notre Service Clients pour connaître la disponibilité de ce produit.


Sélectionner une taille de conditionnement

Changer de vue
20 μG
192,00 €
50 μG
341,00 €

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

192,00 €


Veuillez contacter notre Service Clients pour connaître la disponibilité de ce produit.

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CAAGTGCCATGTGTTTTGCTGTGATGTCCCTGCCAAGGCCATTGCCAGTGCCCTACATGGGCTTTGTGCCCAGATCTTGTCAGAGCGAGTAGAGGTCAGTGGTGATGCCTCTTGCTGCTCCCCAGACCCCATCTCTCCTGAAGACCTGCCACGGCAAGTGGAGCTGCTGGATGCGGTAAGCCAAGCTGCTCAGAAGTACGAGGCACTGTATATGGGGACACTGCCAGTCACCAAGGCCATGGGCATGGATGTGCTGAACGAGGCCATTGGTACCCTCACCGCCAGGGGGGACCGGAATGCCTGGGTCCCCACCATGCTCAGTGTGTCTGACTCTCTCATGACTGCACACCC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Patompon Wongtrakoongate et al.
PLoS genetics, 11(10), e1005615-e1005615 (2015-10-27)
Long non-coding RNAs (lncRNAs) have been recognized as key players in transcriptional regulation. We show that the lncRNA steroid receptor RNA activator (SRA) participates in regulation through complex formation with trithorax group (TrxG) and polycomb repressive complex 2 (PRC2) complexes.

Questions

  1. What is the amount of 20 ug esiRNA in term mol?

    1 answer
    1. esiRNA is a pooled product with a variable molecular weight. The molecular weight can be estimated using the following information:
      - Calculation of esiRNA molar mass
      - A high percentage of the esiRNA pool is 21 bp
      - The average molar mass of one base including sugar and phosphate is 345 g/mol.
      - For an esiRNA (always double stranded) of 21 bp, the average molar mass can be calculated as follows: 2 x 21 x 345 = 14,490 g/mol

      For additional information please refer to the esiRNA technical bulletin in the link below:
      https://www.sigmaaldrich.com/deepweb/assets/sigmaaldrich/product/documents/786/318/cstesirnabul.pdf

      Helpful?

Reviews

No rating value

Active Filters

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique