Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU094831

Sigma-Aldrich

MISSION® esiRNA

targeting human CCDC85C, CCNK

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGTGGGTAAGCAGCAGGGTACCTTGTATAATGCACGACAGTTGCAGTATGGGAAGAATGGACCGGGCCCCTGGGATAAAATCAGAGTGGTCCTCACACCTAGAGGACGGGGACAACCAGCTTTCAGAGTAGCCTCATCAGTGCCCTTGCAGTCTGACTGTGTACACTTGGTTCAGCTAATGTCTGAGAGTCCTGCACTGGGTTACTTTATACTAGTGAGGACGTTAACCAGCCATATTGGCTCAATAAATAGCTTCGGTAAGGAGTTAATTTCCTTCTAGAAATCAGTGCCTATTTTTCCTGGAAACTCAATTTTAAATAGTCCAATTCCATCTGAAGCCAAGCTGTTGTCA

Numéro d'accès Ensembl | humain

ENSG00000090061

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... CCDC85C(317762) , CCNK(8812)

Catégories apparentées

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Sabrina Schecher et al.
International journal of cancer, 141(8), 1643-1653 (2017-07-04)
Cyclin K plays a critical role in transcriptional regulation as well as cell development. However, the role of Cyclin K in prostate cancer is unknown. Here, we describe the impact of Cyclin K on prostate cancer cells and examine the
Kingsley M Ekumi et al.
Nucleic acids research, 43(5), 2575-2589 (2015-02-26)
The Cdk12/CycK complex promotes expression of a subset of RNA polymerase II genes, including those of the DNA damage response. CDK12 is among only nine genes with recurrent somatic mutations in high-grade serous ovarian carcinoma. However, the influence of these

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique