Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU094381

Sigma-Aldrich

MISSION® esiRNA

targeting human SKP2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTCCACGGCATACTGTCTCAGTGTTCCAAGTTGCAGAATCTAAGCCTGGAAGGCCTGCGGCTTTCGGATCCCATTGTCAATACTCTCGCAAAAAACTCAAATTTAGTGCGACTTAACCTTTCTGGGTGTTCTGGATTCTCTGAATTTGCCCTGCAGACTTTGCTAAGCAGCTGTTCCAGACTGGATGAGCTGAACCTCTCCTGGTGTTTTGATTTCACTGAAAAGCATGTACAGGTGGCTGTTGCGCATGTGTCAGAGACCATCACCCAGCTGAATCTTAGCGGCTACAGAAAGAATCTCCAGAAATCAGATCTCTCTACTTTAGTTAGAAGATGCCCCAATCTTGTCCATCTAGACTTAAGTGATAGTGTCATGCTAAAGAATGACTGCTTTCAGGAATTTTTCCAGCTCAACTACCTCCA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Shirly Lahav-Baratz et al.
Reproductive biomedicine online, 32(3), 308-315 (2016-01-23)
This preliminary study examined a possible effect of long duration repeated hormonal stimulation on the endometrium using a molecular tool. The expression of the hormone stimulated, cell cycle regulators, p27 and its ligase S-phase kinase-interacting protein2 (Skp2), were assessed in
Yingduan Cheng et al.
Oncotarget, 8(2), 1972-1982 (2016-12-29)
Recent findings on the existence of oncogenic fusion genes in a wide array of solid tumors, including head and neck squamous cell carcinoma (HNSCC), suggests that fusion genes have become attractive targets for cancer diagnosis and treatment. In this study
Wei Yan et al.
Cancer biotherapy & radiopharmaceuticals, 34(7), 451-458 (2019-04-27)
Background: Mantle cell lymphoma (MCL) is associated with poor patient prognosis mainly due to incomplete response to chemotherapy. S-phase
Gatha Thacker et al.
Life sciences, 257, 118041-118041 (2020-07-06)
Transcription factor CCAAT/Enhancer binding protein alpha (C/EBPα) is a key regulator of myeloid differentiation, granulopoiesis in particular. Although CEBPA mutations are found in more than 10% in AML, functional inhibition of C/EBPα protein is also widely observed in AML. Here
Fan Yao et al.
Nature communications, 9(1), 2269-2269 (2018-06-13)
Dysregulation of YAP localization and activity is associated with pathological conditions such as cancer. Although activation of the Hippo phosphorylation cascade is known to cause cytoplasmic retention and inactivation of YAP, emerging evidence suggests that YAP can be regulated in

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique