Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU094321

Sigma-Aldrich

MISSION® esiRNA

targeting human WNK1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme

Sélectionner une taille de conditionnement

20 μG
192,00 €
50 μG
341,00 €

192,00 €

Veuillez contacter notre Service Clients pour connaître la disponibilité de ce produit.
Toutes les photos(1)

Sélectionner une taille de conditionnement

Changer de vue
20 μG
192,00 €
50 μG
341,00 €

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

192,00 €

Veuillez contacter notre Service Clients pour connaître la disponibilité de ce produit.

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ACCACTTCATTCCCAAGCACAGCTTCACAGCTGTGCATTCAGCTTAGCAGCAGTACTTCTACTCCTACTTTAGCTGAAACCGTGGTAGTTAGCGCACACTCACTAGATAAGACATCTCATAGCAGTACAACTGGATTGGCTTTCTCCCTCTCTGCACCATCTTCCTCTTCCTCTCCTGGAGCAGGAGTGTCTAGTTATATTTCTCAGCCTGGTGGGCTGCATCCTTTGGTCATTCCATCAGTGATAGCTTCTACTCCTATTCTTCCCCAAGCAGCAGGACCTACTTCTACACCTTTATTACCCCAAGTACCTAGTATCCCACCCTTGGTACAGCCTGTTGCCAATGTGCCTGCTGTACAGCAGACACTAATTCATAGTCAGCCTCAACCAGCTTTGCTTCCCAACCAGCCCCATACTCATTG

Numéro d'accès Ensembl | humain

ENSG00000060237

Numéro d'accès NCBI

NM_018979

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... WNK1(65125) , WNK1(65125)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
JUU
WNS
EHS
RPR

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Sukanya Shyamasundar et al.
International journal of oncology, 49(6), 2629-2636 (2016-11-15)
Despite advances in treatment, the highly metastatic nature of breast tumors has given rise to the urgent need for development of novel therapeutic and prognostic markers. miR-93 is known to regulate the epithelial to mesenchymal transition process and to influence
Hui Dong et al.
Journal of cellular physiology, 235(10), 6548-6562 (2020-02-19)
Long noncoding RNAs (lncRNAs) have been recognized as cancer-associated biological molecules, favoring hepatocellular carcinoma (HCC) progression. This study was conducted to elucidate the effects lncRNA lymphoid enhancer-binding Factor 1 antisense RNA (LEF1-AS1) on the pathological development of HCC, along with
Jen-Yu Hung et al.
Oncotarget, 8(38), 63691-63702 (2017-10-04)
The extracellular matrix is a component of physiological microenvironment and a regulator of cellular processes such as migration and proliferation. Secreted Protein Acidic and Rich in Cysteine (SPARC/osteonectin) is an extracellular matrix-associated glycoprotein involved in the regulation of cell proliferation
Perrine Friedel et al.
Science signaling, 8(383), ra65-ra65 (2015-07-02)
Activation of Cl(-)-permeable γ-aminobutyric acid type A (GABAA) receptors elicits synaptic inhibition in mature neurons but excitation in immature neurons. This developmental "switch" in the GABA function depends on a postnatal decrease in intraneuronal Cl(-) concentration mediated by KCC2, a

Questions

Reviews

No rating value

Active Filters

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique