Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU091461

Sigma-Aldrich

MISSION® esiRNA

targeting human XRCC4

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TCAGACTTGGTTCCTTCAACCTAGAGAAAGTTGAAAACCCAGCTGAAGTCATTAGAGAACTTATTTGTTATTGCTTGGACACCATTGCAGAAAATCAAGCCAAAAATGAGCACCTGCAGAAAGAAAATGAAAGGCTTCTGAGAGATTGGAATGATGTTCAAGGACGATTTGAAAAATGTGTGAGTGCTAAGGAAGCTTTGGAGACTGATCTTTATAAGCGGTTTATTCTGGTGTTGAATGAGAAGAAAACAAAAATCAGAAGTTTGCATAATAAATTATTAAATGCAGCTCAAGAACGAGAAAAGGACATCAAACAAGAAGGGGAAACTGCAATCTGTTCTGAAATGACTGCTGACCGAGATCCAGTCTATGATGAGAGTACTGATGAGGAAAGTGAAAACCAAACTGATCTCTCTGGGTTGGCTT

Numéro d'accès Ensembl | humain

ENSG00000152422

Numéro d'accès NCBI

NM_022406

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... XRCC4(7518) , XRCC4(7518)

Catégories apparentées

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Wen Li et al.
Nature cell biology, 21(10), 1273-1285 (2019-09-25)
Chromosome translocation is a major cause of the onset and progression of diverse types of cancers. However, the mechanisms underlying this process remain poorly understood. Here, we identified a non-homologous end-joining protein, IFFO1, which structurally forms a heterotetramer with XRCC4.
Idit Hazan et al.
Cell reports, 29(3), 560-572 (2019-10-17)
DNA double-strand breaks (DSBs) are deleterious and tumorigenic but could also be essential for DNA-based processes. Yet the landscape of physiological DSBs and their role and repair are still elusive. Here, we mapped DSBs at high resolution in cancer and
Masahiro Terasawa et al.
PLoS genetics, 10(8), e1004563-e1004563 (2014-08-29)
DNA double-strand breaks (DSBs) can be repaired by one of two major pathways-non-homologous end-joining (NHEJ) and homologous recombination (HR)-depending on whether cells are in G1 or S/G2 phase, respectively. However, the mechanisms of DSB repair during M phase remain largely

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique