Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU089731

Sigma-Aldrich

MISSION® esiRNA

targeting human SMAD5

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGACCAGGAAGTCCATTTCAGCTCCCAGCTGATACGCCTCCTCCTGCCTATATGCCACCTGATGATCAGATGGGTCAAGATAATTCCCAGCCTATGGATACAAGCAATAATATGATTCCTCAGATTATGCCCAGTATATCCAGCAGGGATGTTCAGCCTGTTGCCTATGAAGAGCCTAAACATTGGTGTTCAATAGTCTACTATGAATTAAACAATCGTGTTGGAGAAGCTTTTCATGCATCTTCTACTAGTGTGTTAGTAGATGGATTCACAGATCCTTCAAATAACAAAAGTAGATTCTGCTTGGGTTTGTTGTCAAATGTTAATCGTAATTCGACAATTGAAAACACTAGGCGACATATTGGAAAAGGTGTTCATCTGTACTATGTTGGTGGAGAGGTGTATGCGGAATGCCTCAGTGACAGCAG

Numéro d'accès Ensembl | humain

ENSG00000113658

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... SMAD5(4090) , SMAD5(4090)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Mateusz Opyrchal et al.
Oncotarget, 8(53), 91803-91816 (2017-12-07)
Although the majority of breast cancers initially respond to the cytotoxic effects of chemotherapeutic agents, most breast cancer patients experience tumor relapse and ultimately die because of drug resistance. Breast cancer cells undergoing epithelial to mesenchymal transition (EMT) acquire a
Moyuan Deng et al.
Cell and tissue research, 361(3), 723-731 (2015-04-07)
Local application of bone morphogenetic protein 2 (BMP2) is known to promote large bone defect healing and BMP2-initiated bone regeneration could be enhanced by an additional mechanical stimulation. The C-terminal 24-a.a. peptide of mechano growth factor (MGF24E), a mechanical-sensitive molecule
Linda T Doan et al.
PloS one, 7(9), e44009-e44009 (2012-09-18)
Insights into Bone morphogenetic protein (Bmp) functions during forebrain development have been limited by a lack of Bmp signaling readouts. Here we used a novel Bmp signaling reporter ("BRE-gal" mice) to study Bmp signaling in the dorsal telencephalon. At early
Mingyue Nie et al.
Biology of reproduction, 93(4), 98-98 (2015-09-25)
In mammals, follicular atresia can be partially triggered by granulosa cell apoptosis. However, very little is known about the functions of miRNAs in granulosa cell apoptosis. We previously reported that hsa-mir-23a (miR-23a) and hsa-mir-27a (miR-27a) were highly expressed in the

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique