Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU085641

Sigma-Aldrich

MISSION® esiRNA

targeting human CTSB

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ACAGGGTCTGAAGGACTGGATTGGCCAAACATCAGACCTGTCTTCCAAGGAGACCAAGTCCTGGCTACATCCCAGCCTGTGGTTACAGTGCAGACAGGCCATGTGAGCCACCGCTGCCAGCACAGAGCGTCCTTCCCCCTGTAGACTAGTGCCGTAGGGAGTACCTGCTGCCCCAGCTGACTGTGGCCCCCTCCGTGATCCATCCATCTCCAGGGAGCAAGACAGAGACGCAGGAATGGAAAGCGGAGTTCCTAACAGGATGAAAGTTCCCCCATCAGTTCCCCCAGTACCTCCAAGCAAGTAGCTTTCCACATTTGTCACAGAAATCAGAGGAGAGACGGTGTTGGGAGCCCTTTGGAGAACGCCAGTCTCCCAGGCCCCCTGCATCTATCGAGTTTGCAATGTCACAACCTCTCTGATCTTGTGCTCAGCA

Numéro d'accès Ensembl | humain

ENSG00000164733

Numéro d'accès NCBI

NM_001908

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... CTSB(1508) , CTSB(1508)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Fengming Gong et al.
Molecular cancer, 12(1), 125-125 (2013-10-22)
The lung squamous cell carcinoma survival rate is very poor despite multimodal treatment. It is urgent to discover novel candidate biomarkers for prognostic assessment and therapeutic targets to lung squamous cell carcinoma (SCC). Herein a two-dimensional gel electrophoresis and ESI-Q-TOF
Xin Zhang et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 107, 390-396 (2018-08-14)
Resistance to adjuvant radiotherapy is a major cause of treatment failure in patients with glioblastoma (GBM). Recently, the role of lysosome, especially lysosomal proteases, in radioresistance is being paid more and more attention to. Here, we investigated the radioresistant role
Ana Mitrović et al.
European journal of cell biology, 96(6), 622-631 (2017-05-13)
Cathepsins B and X are lysosomal cysteine carboxypeptidases suggested as having a redundant role in cancer. They are involved in a number of processes leading to tumor progression but their role in the epithelial-mesenchymal transition (EMT) remains unknown. We have
Man Kyu Shim et al.
Biomaterials, 261, 120347-120347 (2020-09-06)
Chemotherapy has shown remarkable therapeutic efficacy for various types of cancer. However, drug resistance reduces the effectiveness and sensitivity of chemotherapy, leading treatment failure and cancer relapse in many clinical indications. Herein, we propose cancer-specific drug-drug nanoparticles (DD-NPs) that improve
Man Kyu Shim et al.
Journal of controlled release : official journal of the Controlled Release Society, 294, 376-389 (2018-12-15)
Cancer nanomedicine using nanoparticle-based delivery systems has shown outstanding promise in recent decades for improving anticancer treatment. However, limited targeting efficiency, low drug loading efficiency and innate toxicity of nanoparticles have caused severe problems, leaving only a few available in
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique