Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU085221

Sigma-Aldrich

MISSION® esiRNA

targeting human SHC1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme

Sélectionner une taille de conditionnement

20 μG
192,00 €
50 μG
341,00 €

192,00 €


Veuillez contacter notre Service Clients pour connaître la disponibilité de ce produit.


Sélectionner une taille de conditionnement

Changer de vue
20 μG
192,00 €
50 μG
341,00 €

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

192,00 €


Veuillez contacter notre Service Clients pour connaître la disponibilité de ce produit.

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGTGTGGTTCGGACTAAGGATCACCGCTTTGAAAGTGTCAGTCACCTTATCAGCTACCACATGGACAATCACTTGCCCATCATCTCTGCGGGCAGCGAACTGTGTCTACAGCAACCTGTGGAGCGGAAACTGTGATCTGCCCTAGCGCTCTCTTCCAGAAGATGCCCTCCAATCCTTTCCACCCTATTCCCTAACTCTCGGGACCTCGTTTGGGAGTGTTCTGTGGGCTTGGCCTTGTGTCAGAGCTGGGAGTAGCATGGACTCTGGGTTTCATATCCAGCTGAGTGAGAGGGTTTGAGTCAAAAGCCTGGGTGAGAATCCTGCCTCTCCCCAAACATTAATCACCAAAGTATTAATGTACAGAGTGGCCCCTCACCTGGGCCTTTCCTGTGCCAACCTGAT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Hyo Jung Shin et al.
International journal of nanomedicine, 15, 2379-2390 (2020-04-21)
Osteoarthritis (OA) is the most common type of joint disease associated with cartilage breakdown. However, the role played by mitochondrial dysfunction in OA remains inadequately understood. Therefore, we investigated the role played by p66shc during oxidative damage and mitochondrial dysfunction
Yukun Zhang et al.
Aging, 12(3), 2049-2069 (2020-02-06)
Hepatic steatosis and oxidative stress are considered to be the sequential steps in the development of non-alcoholic fatty liver disease (NAFLD). We previously found that catalpol, an iridoid glucoside extracted from the root of Romania glutinosa L, protected against diabetes-induced
Zhecheng Wang et al.
Molecular therapy. Nucleic acids, 21, 751-763 (2020-08-12)
We previously found that inhibition of p66Shc confers protection against hepatic stellate cell (HSC) activation during liver fibrosis. However, the effect of p66Shc on HSC proliferation, as well as the mechanism by which p66Shc is modulated, remains unknown. Here, we
Shuyu Piao et al.
Biochemical and biophysical research communications, 522(4), 869-875 (2019-12-07)
Inhibition of mitochondrial protein CR6 interacting factor 1 (CRIF1) disturbs mitochondrial function, depolarizes membrane potential, and increases reactive oxygen species (ROS) levels in endothelial cells. Impaired mitochondrial function accompanied by oxidative damage is a major contributor to the initiation of
Nara Shin et al.
Polymers, 12(5) (2020-05-06)
p66shc, a member of the shc adaptor protein family, has been shown to participate in regulation of mitochondrial homeostasis, apoptosis, and autophagosome formation. The present study was performed to investigate whether p66shc siRNA-encapsulated poly(d,l-lactic-co-glycolic acid) nanoparticles (p66shc siRNA-PLGA NPs) can

Questions

Reviews

No rating value

Active Filters

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique