Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU082071

Sigma-Aldrich

MISSION® esiRNA

targeting human VAPB

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CAGTTCTGTCCAAGCCATCAGCTCCTTGGGACTGATGAACAGAGTCAGAAGCCCAAAGGAATTGCACTGTGGCAGCATCAGACGTACTCGTCATAAGTGAGAGGCGTGTGTTGACTGATTGACCCAGCGCTTTGGAAATAAATGGCAGTGCTTTGTTCACTTAAAGGGACCAAGCTAAATTTGTATTGGTTCATGTAGTGAAGTCAAACTGTTATTCAGAGATGTTTAATGCATATTTAACTTATTTAATGTATTTCATCTCATGTTTTCTTATTGTCACAAGAGTACAGTTAATGCTGCGTGCTGCTGAACTCTGTTGGGTGAACTGGTATTGCTGCTGGAGGGCTGTGGGCTCCTCTGTCTCTGGAGAGTCTGGTCATGTGGAGGTGGGGTTTATTGGGAT

Numéro d'accès Ensembl | humain

ENSG00000124164

Numéro d'accès NCBI

NM_004738

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... VAPB(9217) , VAPB(9217)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Parikshit Bagchi et al.
Nature communications, 11(1), 1127-1127 (2020-03-01)
Although viruses must navigate the complex host endomembrane system to infect cells, the strategies used to achieve this is unclear. During entry, polyomavirus SV40 is sorted from the late endosome (LE) to the endoplasmic reticulum (ER) to cause infection, yet
Thaddaeus Mutugi Nthiga et al.
The EMBO journal, 39(15), e103649-e103649 (2020-06-12)
The endoplasmic reticulum (ER) plays important roles in protein synthesis and folding, and calcium storage. The volume of the ER and expression of its resident proteins are increased in response to nutrient stress. ER-phagy, a selective form of autophagy, is

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique