Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU081471

Sigma-Aldrich

MISSION® esiRNA

targeting human NR1I2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme

Sélectionner une taille de conditionnement

20 μG
192,00 €
50 μG
341,00 €

192,00 €


Veuillez contacter notre Service Clients pour connaître la disponibilité de ce produit.


Sélectionner une taille de conditionnement

Changer de vue
20 μG
192,00 €
50 μG
341,00 €

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

192,00 €


Veuillez contacter notre Service Clients pour connaître la disponibilité de ce produit.

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGTGTCTCTGCATCCATTTGAACACATTATTAAGCACCGATAATAGGTAGCCTGCTGTGGGGTATACAGCATTGACTCAGATATAGATCCTGAGCTCACAGAGTTTATAGTTAAAAAAACAAACAGAAACACAAACGATTTGGATCAAAAGGAGAAATGATAAGTGACAAAAGCAGCACAAGGAATTTCCCTGTGTGGATGCTGAGCTGTGATGGCGGGCACTGGGTACCCAAGTGAAGGTTCCCAAGGACATGAGTCTGTAGGAGCAAGGGCACAAACTGCAGCTGTGAGTGCGTGTGTGTGATTTGGTGTAGGTAGGTCTGTTTGCCACTTGATGGGGCCTGGGTTTGTTCCTGGGGCTGGAATGCTGGGTATGCTCTGTGACAAGGCTACGCTGACAATCA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

Si vous avez besoin d'assistance, veuillez contacter Service Clients

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Wenjing Luo et al.
British journal of pharmacology, 174(8), 700-717 (2017-01-28)
Imatinib mesylate (IM) is a first-line treatment for chronic myeloid leukaemia (CML) as a specific inhibitor of BCR-ABL tyrosine kinase. As IM is widely used in CML, in combination with other drugs, the effects of IM on drug-metabolizing enzymes (DMEs)
Omozuanvbo Aisiku et al.
Blood, 125(12), 1976-1985 (2015-01-15)
Protease-activated receptor-1 (PAR1) couples the coagulation cascade to platelet activation during myocardial infarction and to endothelial inflammation during sepsis. This receptor demonstrates marked signaling bias. Its activation by thrombin stimulates prothrombotic and proinflammatory signaling, whereas its activation by activated protein
Yiqiang Xie et al.
Pakistan journal of pharmaceutical sciences, 31(5(Special)), 2315-2321 (2018-11-23)
Feng-Liao-Chang-Wei-Kang (FLCWK), a traditional Chinese patent medicine, consists primarily of Polygonum hydropiper and Daphniphyllum calycinum roots. As a complex containing several kinds of flavonoids, FLCWK has the potential to impact the drug metabolism enzyme P450 3A4 (CYP3A4) and nuclear receptors.
Yan Chen et al.
Cancer medicine, 5(12), 3564-3571 (2016-11-24)
Cytochrome P450 2C8 (CYP2C8) is one of the enzymes that primarily participate in producing metabolisms of medications and P-glycoprotein (P-gp) has been regarded as one of the important molecules in chemotherapeutically induced multidrug resistance (MDR). In addition, the pregnane X
M Semeniuk et al.
Archives of toxicology, 94(5), 1625-1635 (2020-03-19)
P-glycoprotein (P-gp) is an ABC transporter exhibiting high pharmacotoxicological relevance by extruding a wide range of cytotoxic compounds out of the cells. Previously, we demonstrated that the phytoestrogen genistein (GNT) modulates P-gp expression in hepatocellular carcinoma in vitro. Although several

Questions

Reviews

No rating value

Active Filters

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique