Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU080731

Sigma-Aldrich

MISSION® esiRNA

targeting human RAPGEF4

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGCACTAACGTGGGAGAAACTGCCAAGCAAGTTCAAGAAGTTCTATGCGGAGTTTGAAAGTTTAATGGACCCTTCAAGGAACCACAGGGCCTACAGGCTGACAGTAGCTAAGCTGGAACCTCCTCTCATCCCCTTCATGCCTTTGCTCATTAAAGATATGACATTTACTCATGAGGGGAACAAGACGTTCATTGACAATCTAGTAAACTTTGAAAAAATGCGCATGATTGCAAATACGGCCAGAACAGTGAGATACTACAGGAGCCAACCCTTCAATCCTGATGCAGCTCAAGCTAATAAGAACCATCAGGATGTCCGGAGTTATGTACGGCAATTAAATGTGATTGACAACCAGAGAACTTTATCACAGATGTCACACAGATTAGAGCCTCGTCGACCATAGA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Kazuya Kusama et al.
Reproduction, fertility, and development (2018-05-08)
Protein kinase A (PKA) signalling accompanies elevated intracellular cAMP levels during endometrial stromal cell (ESC) decidualisation. Exchange protein directly activated by cAMP (EPAC), an alternate mediator of cAMP signalling, promotes PKA analogue-induced decidualisation; however, the precise mechanism by which EPAC
Wei Sun et al.
Biochemical and biophysical research communications, 485(2), 355-359 (2017-02-22)
Cyclic adenosine 3'-5'-monophosphate (cAMP) plays a crucial role in regulating pituitary cell proliferation and hormone synthesis. Recent evidence suggests that exchange proteins directly activated by cAMP (Epacs) may mediate the effects of cAMP. Here we used rat anterior pituitary GH3
Kazuya Kusama et al.
Reproduction (Cambridge, England), 147(6), 897-906 (2014-03-04)
The optimal decidualization of endometrial stromal cells (ESCs) following embryo implantation is one of the critical steps to establish pregnancy in rodents and humans. This step is intricately regulated by ovarian hormones. Using in vitro human ESCs model, we previously

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique