Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU079561

Sigma-Aldrich

MISSION® esiRNA

targeting human HMGCR

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme

Sélectionner une taille de conditionnement

20 μG
192,00 €
50 μG
341,00 €

192,00 €


Veuillez contacter notre Service Clients pour connaître la disponibilité de ce produit.


Sélectionner une taille de conditionnement

Changer de vue
20 μG
192,00 €
50 μG
341,00 €

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

192,00 €


Veuillez contacter notre Service Clients pour connaître la disponibilité de ce produit.

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGCATTTGACAGCACTAGCAGATTTGCACGTCTACAGAAACTTCATACAAGTATAGCTGGACGCAACCTTTATATCCGTTTCCAGTCCAGGTCAGGGGATGCCATGGGGATGAACATGATTTCAAAGGGTACAGAGAAAGCACTTTCAAAACTTCACGAGTATTTCCCTGAAATGCAGATTCTAGCCGTTAGTGGTAACTATTGTACTGACAAGAAACCTGCTGCTATAAATTGGATAGAGGGAAGAGGAAAATCTGTTGTTTGTGAAGCTGTCATTCCAGCCAAGGTTGTCAGAGAAGTATTAAAGACTACCACAGAGGCTATGATTGAGGTCAACATTAACAAGAATTTAGTGGGCTCTGCCATGGCTGGGAGCATAGGAGGCTACAACGCCCATGCAGCAAACATTGTCACCGCCATCTACATTGCCTGTGGACAGGA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Olöf Bjarnadottir et al.
Scientific reports, 10(1), 558-558 (2020-01-19)
Statins, commonly used to treat hypercholesterolemia, have also been proposed as anti-cancer agents. The identification of a predictive marker is essential. The 3-hydroxy-3-methylglutaryl-coenzyme-A reductase (HMGCR), which is inhibited by statins, might serve as such a marker. Thorough antibody validation was
Chang-Sook Hong et al.
Journal of extracellular vesicles, 9(1), 1800979-1800979 (2020-09-19)
Most patients with acute myeloid leukaemia (AML) experience disease recurrence after chemotherapy largely due to the development of drug resistance. Small extracellular vesicles (sEVs) are known to play a significant role in leukaemia drug resistance by delivery of anti-apoptotic proteins
Robin A Lu et al.
Frontiers in pharmacology, 11, 469-469 (2020-05-22)
Despite maximal use of currently available therapies, a significant number of asthma patients continue to experience severe, and sometimes life-threatening bronchoconstriction. To fill this therapeutic gap, we examined a potential role for the 3-hydroxy-3-methylglutaryl-coenzyme A reductase (HMGCR) inhibitor, pitavastatin. Using
Jiajun Huang et al.
EBioMedicine, 45, 251-260 (2019-06-16)
Statin-associated muscle symptoms (SAMS) are the major adverse effects of the class of widely used lipid-lowering agents, and the underlying mechanism remains elusive. In this study, we investigated the potential contribution and molecular mechanism of increased lactate production to SAMS

Questions

Reviews

No rating value

Active Filters

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique