Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU078741

Sigma-Aldrich

MISSION® esiRNA

targeting human GAB2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme

Sélectionner une taille de conditionnement

20 μG
192,00 €
50 μG
341,00 €

192,00 €


Veuillez contacter notre Service Clients pour connaître la disponibilité de ce produit.


Sélectionner une taille de conditionnement

Changer de vue
20 μG
192,00 €
50 μG
341,00 €

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

192,00 €


Veuillez contacter notre Service Clients pour connaître la disponibilité de ce produit.

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCTCCCAAACAATGACTTCCTGCCATGTTTGATGGGGACAGCTACCACTGTCCTCTGCCCCCATTCCCCTTTCAGCTCCCATGAGCATGCATAGTTCACCAGACCAATGGCCTAGCCATTCTCTAAGTCCCATCCTGGAAGAAGTTATTTCTTCAAGAGCTGCACCTCTCCTCCTAGCATTAGTTTAGATCAACTCAAGGAGTATTTATTAATGGCTGCTGTCTCCAGTTTCTGGGGTTAAGCACTAAGGACACAAGAATCAATCAGACCTTCTCCCTGAACTTAAGATAGCCACAATCAGAAAAAGGACAAGGACATGAGACAGTGGTGATGGCCATCAGACAGAGACTTCAAATGCTGATGGAGGGCAGAGGAAGTACTTAGGGAGGTTGGTGTCAGAGGCAG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Xiang-Rui Qiao et al.
Oncology letters, 20(4), 99-99 (2020-08-25)
The development of prostate cancer is complicated and involves a number of tumor-associated gene expression level abnormalities. Gene chip technology is a high-throughput method that can detect gene expression levels in different tissues and cells on a large scale. In
Wen Jie Wang et al.
International journal of clinical and experimental pathology, 8(9), 10575-10584 (2015-12-01)
Non-small cell lung cancer (NSCLC) is a leading cause of cancer-related death and often has a poor prognosis. Investigation of NSCLC cancer cell migration, invasion and development of strategies to block this process is essential to improve the disease prognosis.
Yiping Huang et al.
Biochemical and biophysical research communications, 503(3), 2028-2032 (2018-08-11)
The functionality of lncRNA snaR has only been characterized in breast cancer and colon cancer. The aim of the current study is to explore the involvement of lncRNA snaR in ovarian carcinoma (OC). Expression of lncRNA snaR and GRB2-associated binding
Peng Zhang et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 50(1), 52-65 (2018-10-17)
HER2 has been implicated in mammary tumorigenesis as well as aggressive tumor growth and metastasis. Its overexpression is related to a poor prognosis and chemoresistance in breast cancer patients. Although Grb2-associated binding protein 2 (Gab2) is important in the development
Lan Yang et al.
The Journal of biological chemistry, 290(44), 26627-26637 (2015-09-12)
Proteinase activated-receptor 2 (PAR2) participates in cancer metastasis promoted by serine proteinases. The current study aimed to test the molecular mechanism by which PAR2 promotes cancer cell migration. In different cancer cells, activation of PAR2 by activating peptide (PAR2-AP) dramatically

Questions

Reviews

No rating value

Active Filters

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique