Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU075951

Sigma-Aldrich

MISSION® esiRNA

targeting human FBXW7

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme

Sélectionner une taille de conditionnement

20 μG
192,00 €
50 μG
341,00 €

192,00 €

Veuillez contacter notre Service Clients pour connaître la disponibilité de ce produit.
Toutes les photos(1)

Sélectionner une taille de conditionnement

Changer de vue
20 μG
192,00 €
50 μG
341,00 €

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

192,00 €

Veuillez contacter notre Service Clients pour connaître la disponibilité de ce produit.

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CAGCAGTCACAGGCAAATGTCTGAGAACATTAGTGGGACATACAGGTGGAGTATGGTCATCACAAATGAGAGACAACATCATCATTAGTGGATCTACAGATCGGACACTCAAAGTGTGGAATGCAGAGACTGGAGAATGTATACACACCTTATATGGGCATACTTCCACTGTGCGTTGTATGCATCTTCATGAAAAAAGAGTTGTTAGCGGTTCTCGAGATGCCACTCTTAGGGTTTGGGATATTGAGACAGGCCAGTGTTTACATGTTTTGATGGGTCATGTTGCAGCAGTCCGCTGTGTTCAATATGATGGCAGGAGGGTTGTTAGTGGAGCATATGATTTTATGGTAAAGGTGTGGGATCCAGAGACTGAAACCTGTCTACACACGTTGCAGGGGCATACTAAT

Numéro d'accès Ensembl | humain

ENSG00000109670

Numéro d'accès NCBI

NM_033632

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... FBXW7(55294) , FBXW7(55294)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
DCV
XZU
ZYU
KXU
BWU

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Qiang Fu et al.
Aging, 11(24), 11865-11879 (2019-12-28)
Our study aspires to understand the impact of miR-27b on myocardial fibrosis as well as its functional mechanism. 12 days post the ligation of coronary artery in rats, the expression of miR-27b in the peri-infarction region was elevated. Treating cultivated
Veronika Reiterer et al.
The EMBO journal, 36(3), 260-273 (2016-12-23)
The F-box protein FBXW7 is the substrate-recruiting subunit of an SCF ubiquitin ligase and a major tumor-suppressor protein that is altered in several human malignancies. Loss of function of FBXW7 results in the stabilization of numerous proteins that orchestrate cell
Hui Wang et al.
Cancer cell international, 20, 258-258 (2020-06-25)
Cisplatin is widely used as a first-line treatment for non-small cell lung cancer (NSCLC), but chemoresistance remains a major clinical obstacle for efficient use. As a microRNA, miR-223 was reported to promote the doxorubicin resistance of NSCLC. However, whether miR-223
Mariusz L Hartman et al.
Molecular carcinogenesis, 58(4), 588-602 (2018-12-18)
We have extensively studied the phenotypic heterogeneity of patient-derived melanoma cells. Here, whole-exome sequencing revealed novel variants of genes associated with the MAPK, NOTCH, Hippo, cell-cycle, senescence, and ubiquitin-dependent pathways, which could contribute to the observed phenotypic diversity between cell
Bei Wang et al.
Molecular therapy. Nucleic acids, 19, 1299-1308 (2020-03-13)
Induction of endogenous cardiomyocyte (CM) proliferation is one of the key strategies for heart regeneration. Increasing evidence points to the potential role of microRNAs (miRNAs) in the regulation of CM proliferation. Here, we used human embryonic stem cell (hESC)-derived CMs
Afficher tous les articles scientifiques apparentés

Questions

Reviews

No rating value

Active Filters

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique