Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU070341

Sigma-Aldrich

MISSION® esiRNA

targeting human MMP16

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CGGTGTACCTGACCAGACAAGAGGTAGCTCCAAATTTCATATTCGTCGAAAGCGATATGCATTGACAGGACAGAAATGGCAGCACAAGCACATCACTTACAGTATAAAGAACGTAACTCCAAAAGTAGGAGACCCTGAGACTCGTAAAGCTATTCGCCGTGCCTTTGATGTGTGGCAGAATGTAACTCCTCTGACATTTGAAGAAGTTCCCTACAGTGAATTAGAAAATGGCAAACGTGATGTGGATATAACCATTATTTTTGCATCTGGTTTCCATGGGGACAGCTCTCCCTTTGATGGAGAGGGAGGATTTTTGGCACATGCCTACTTCCCTGGACCAGGAATTGGAGGAGATACCCATTTTGACTCAGATGAGCCATGGACACTAGGAAATCCTAATCATGATGGAAATGACTTATTTCTTGTAGCAGTCCATGAACTGGGACATGCTCTG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Hanan S Elsarraj et al.
NPJ breast cancer, 6, 12-12 (2020-05-01)
The molecular processes by which some human ductal carcinoma in situ (DCIS) lesions advance to the more aggressive form, while others remain indolent, are largely unknown. Experiments utilizing a patient-derived (PDX) DCIS Mouse INtraDuctal (MIND) animal model combined with ChIP-exo
Ji Wook Moon et al.
Cancer genetics, 208(5), 261-270 (2015-05-24)
The gene MT3-MMP (also known as MMP16) encodes the membrane type 3 matrix metalloproteinase, which is a member of the matrix metalloproteinase (MMP) gene family. Several MMPs are associated with migration in colorectal cancer (CRC). However, the methylation status of

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique