Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU070111

Sigma-Aldrich

MISSION® esiRNA

targeting human CCNE1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ATCCTCCAAAGTTGCACCAGTTTGCGTATGTGACAGATGGAGCTTGTTCAGGAGATGAAATTCTCACCATGGAATTAATGATTATGAAGGCCCTTAAGTGGCGTTTAAGTCCCCTGACTATTGTGTCCTGGCTGAATGTATACATGCAGGTTGCATATCTAAATGACTTACATGAAGTGCTACTGCCGCAGTATCCCCAGCAAATCTTTATACAGATTGCAGAGCTGTTGGATCTCTGTGTCCTGGATGTTGACTGCCTTGAATTTCCTTATGGTATACTTGCTGCTTCGGCCTTGTATCATTTCTCGTCATCTGAATTGATGCAAAAGGTTTCAGGGTATCAGTGGTGCGACATAGAGAACTGTGTCAAGTGGATGGTTCCATTTGCCATGGTTATAAGGGAGACGGGGA

Numéro d'accès Ensembl | humain

ENSG00000105173

Numéro d'accès NCBI

NM_001238

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... CCNE1(898) , CCNE1(898)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

X Zhang et al.
Neoplasma, 66(5), 704-716 (2019-05-28)
Previous studies have reported that miR-107 could be utilized as a potential peripheral biomarker in prostate cancer (PCa). However, the specific functions of miR-107 in prostate cancer and its relevant mechanisms are still unknown. The aim of this research was
Wei-Wei Liu et al.
Cancer management and research, 13, 439-447 (2021-01-28)
To explore the regulatory role of miR497-5p-CCNE1 axis in triple-negative breast cancer (TNBC) cells and its predictive value for early diagnosis. Cancer tissue and adjacent tissue samples were collected from 86 patients with TNBC.RT-PCR was used to detect the expression
Caishang Zheng et al.
Scientific reports, 7(1), 16422-16422 (2017-11-29)
Enterovirus 71 (EV71) is the predominant causative pathogen of hand-foot-and-mouth disease (HFMD). Contrary to other HFMD-causing enterovirus, EV71 can lead to severe neurological complications, even death. MicroRNAs (miRNAs) are small non-coding RNAs that constitute the largest family of gene regulators
Ran Wei et al.
Journal of orthopaedic research : official publication of the Orthopaedic Research Society, 38(9), 1952-1964 (2020-03-13)
While amplified expressed cyclin E1 is a well-known tumorigenic factor and prognostic biomarker in several malignancies, its prognostic predictive potential and function in osteosarcoma is poorly understood. Here we reveal discrete expression pattern, correlation to clinicopathological characteristics and prognosis and
Pilar Alonso-Lecue et al.
Cell death & disease, 8(6), e2901-e2901 (2017-07-01)
Squamous cell carcinoma (SCC) or epidermoid cancer is a frequent and aggressive malignancy. However in apparent paradox it retains the squamous differentiation phenotype except for very dysplastic lesions. We have shown that cell cycle stress in normal epidermal keratinocytes triggers
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique