Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU064911

Sigma-Aldrich

MISSION® esiRNA

targeting human CUL4B

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCAGGCAACTGGAATAGAGGATGGAGAGTTAAGGAGAACACTGCAGTCATTAGCCTGTGGCAAAGCTAGAGTTCTGGCGAAAAATCCAAAGGGCAAAGACATTGAAGATGGTGACAAGTTCATTTGTAATGATGATTTCAAACATAAACTTTTCAGGATAAAGATCAATCAAATCCAGATGAAAGAAACGGTTGAAGAACAAGCAAGCACTACAGAAAGAGTATTTCAAGACAGACAGTATCAAATTGATGCTGCAATTGTTCGAATTATGAAGATGAGAAAGACACTTAGCCACAATCTCCTTGTTTCAGAAGTGTACAACCAGTTGAAATTTCCAGTAAAGCCTGCTGATCTTAAGAAGAGAATAGAATCTTTAATTGACCGGGACTACATGGAAAGAGATAAAGAAAATCCAAACCAGTACAACTATATTGCATAGAATGTTGGCCTTGCAGCATTTGGTGTCAT

Numéro d'accès Ensembl | humain

ENSG00000158290

Numéro d'accès NCBI

NM_003588

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... CUL4B(8450) , CUL4B(8450)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Anbarasu Kumaraswamy et al.
The Journal of biological chemistry, 293(40), 15691-15705 (2018-08-25)
c-Myc is a proto-oncogene controlling expression of multiple genes involved in cell growth and differentiation. Although the functional role of c-Myc as a transcriptional regulator has been intensively studied, targeting this protein in cancer remains a challenge. Here, we report
Mingfeng Zhao et al.
The Prostate, 79(5), 480-488 (2019-01-05)
Cullin 4B (CUL4B), a scaffold protein that assembles CRL4B ubiquitin ligase complexes, is overexpressed in many types of solid tumors and contributes to epigenetic silencing of tumor suppressors. However, its clinical significance and underlying molecular mechanisms in prostate cancer (PCa)
Ye Lin et al.
Epigenetics & chromatin, 12(1), 22-22 (2019-04-18)
Neural tube defects (NTDs) are common birth defects involving the central nervous system. Recent studies on the etiology of human NTDs have raised the possibility that epigenetic regulation could be involved in determining susceptibility to them. Here, we show that

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique