Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU061331

Sigma-Aldrich

MISSION® esiRNA

targeting human PBX1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme

Sélectionner une taille de conditionnement

20 μG
192,00 €
50 μG
341,00 €

192,00 €


Veuillez contacter notre Service Clients pour connaître la disponibilité de ce produit.


Sélectionner une taille de conditionnement

Changer de vue
20 μG
192,00 €
50 μG
341,00 €

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

192,00 €


Veuillez contacter notre Service Clients pour connaître la disponibilité de ce produit.

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGGGGCAGGTTCAGACAACTCAGTGGAGCATTCAGATTACAGAGCCAAACTCTCACAGATCAGACAAATCTACCATACGGAGCTGGAGAAATACGAGCAGGCCTGCAACGAGTTCACCACCCACGTGATGAATCTCCTGCGAGAGCAAAGCCGGACCAGGCCCATCTCCCCAAAGGAGATTGAGCGGATGGTCAGCATCATCCACCGCAAGTTCAGCTCCATCCAGATGCAGCTCAAGCAGAGCACGTGCGAGGCGGTGATGATCCTGCGTTCCCGATTTCTGGATGCGCGGCGGAAGAGACGGAATTTCAACAAGCAAGCGACAGAAATCCTGAATGAATATTTCTATTCCCATCTCAGCAACCCTTACCCCAGTGAGGAAGCCAAAGAGGAGTTAGCCAAGAAGTGTGGCATCACA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Xin Wei et al.
Biochemical and biophysical research communications, 500(3), 650-657 (2018-04-22)
PBX1 was abnormally overexpressed and its intracellular localization was found to be frequently amplified in many types of cancer, including renal clear cell carcinoma. PBX1 displays oncogenic activity in several different types of cells, but little is known about how
Changyu He et al.
Oncotarget, 8(29), 46818-46833 (2017-05-18)
Pre-B-cell leukemia homeobox 1 (PBX1) was originally identified as a proto-oncogene in human leukemia. Although this protein has been shown to contribute to cellular development and tumorigenesis, the role of PBX1 in gastric carcinoma (GC) remains unclear. In this study
Chiou-Hong Lin et al.
Scientific reports, 9(1), 4915-4915 (2019-03-22)
The PBX1 homeodomain transcription factor is converted by t(1;19) chromosomal translocations in acute leukemia into the chimeric E2A-PBX1 oncoprotein. Fusion with E2A confers potent transcriptional activation and constitutive nuclear localization, bypassing the need for dimerization with protein partners that normally
Yonggang Zhou et al.
Science translational medicine, 12(537) (2020-04-03)
Abundant decidual natural killer (dNK) cells at the maternal-fetal interface are important during early pregnancy. However, functional subsets of dNK cells remain poorly understood. We describe a CD49a+PBX homeobox 1 (PBX1)+ dNK cell subset that promotes fetal development in humans

Questions

Reviews

No rating value

Active Filters

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique