Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU058031

Sigma-Aldrich

MISSION® esiRNA

targeting human KCNK2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGAAGACGGTCTCCACGATATTCCTGGTGGTTGTCCTCTATCTGATCATCGGAGCCACCGTGTTCAAAGCATTGGAGCAGCCTCATGAGATTTCACAGAGGACCACCATTGTGATCCAGAAGCAAACATTCATATCCCAACATTCCTGTGTCAATTCGACGGAGCTGGATGAACTCATTCAGCAAATAGTGGCAGCAATAAATGCAGGGATTATACCGTTAGGAAACACCTCCAATCAAATCAGTCACTGGGATTTGGGAAGTTCCTTCTTCTTTGCTGGCACTGTTATTACAACCATAGGATTTGGAAACATCTCACCACGCACAGAAGGCGGCAAAATATTCTGTATCATCTATGCCTTACTGGGAATTCCCCTCTTTGGTTTTCTCTTGGCTGGAGTTGGAGATCAGCTAGGCACCATATTTGGAAAAGGAATTGCCAAAG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

Si vous avez besoin d'assistance, veuillez contacter Service Clients

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Oleg Yarishkin et al.
Investigative ophthalmology & visual science, 60(6), 2294-2303 (2019-05-23)
The concentration of protons in the aqueous humor (AH) of the vertebrate eye is maintained close to blood pH; however, pathologic conditions and surgery may shift it by orders of magnitude. We investigated whether and how changes in extra- and
Haiyun Guo et al.
BMC anesthesiology, 17(1), 124-124 (2017-09-06)
There are growing concerns that anaesthetic exposure can cause extensive apoptotic degeneration of neurons and the impairment of normal synaptic development and remodelling. However, little attention has been paid to exploring the possible cytotoxicity of inhalation anaesthetics, such as isoflurane
Ricardo H Pineda et al.
American journal of physiology. Renal physiology, 313(2), F535-F546 (2017-05-26)
Detrusor overactivity (DO) is the abnormal response of the urinary bladder to physiological stretch during the filling phase of the micturition cycle. The mechanisms of bladder smooth muscle compliance upon the wall stretch are poorly understood. We previously reported that
Junsung Woo et al.
The Journal of physiology, 598(20), 4555-4572 (2020-07-25)
Neuronal activity causes astrocytic volume change via K+ uptake through TREK-1 containing two-pore domain potassium channels. The volume transient is terminated by Cl- efflux through the Ca2+ -activated anion channel BEST1. The source of the Ca2+ required to open BEST1

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique